|
| Status |
Public on Dec 30, 2023 |
| Title |
H751L.IP.rep1 |
| Sample type |
SRA |
| |
|
| Source name |
whole animal
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
tissue: whole animal
genotype: alg-1(zen18,H751L)
|
| Treatment protocol |
Synchronized populations of developing worms were cultured at 20 °C for 45 hrs after feeding. Harvested worms were washed with water three times and incubated at room temperature for 10 min to allow digestion of intestinal bacteria. Worms were then pelleted by centrifuge at 4,500 rcf for 2 min at room temperature and residual water was removed until the total volumes were twice as the worm pellets. The samples were then flashed frozen by liquid nitrogen and stored at -80 °C.
|
| Growth protocol |
C. elegans were cultured on nematode growth medium (NGM) and fed with E. coli HB101. To obtain populations of synchronized developing worms, gravid adults were collected and washed twice with water. Pellets of centrifuged worms were treated with 5 ml 1N NaOH and 1% (v/v) sodium hypochlorite for 4 min with shaking to obtain embryos, and the embryos were rinsed with M9 buffer three times. The embryos were hatched in 10 ml M9 buffer at 20°C for 16-18 hrs with mild shaking. Hatched L1 larvae were transferred to plates at 30-50 worms per plate and replicate plates were cultured at 20°C for defined periods of time; samples of the population were examined by microscopy to confirm the developmental stages at the time of harvest.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total (“input”) lysates and “IP” samples were subjected to RNA preparation as described above. Purified RNA was subjected to gel-based size selection.
NEXTflex Small RNA Library Prep kit v3 (PerkinElmer, cat# NOVA-5132) was used to prepare libraries according to the manufacturer’s instructions, followed by size selection of final PCR products. Libraries were sequenced using the Illumina Nextseq500 platform at the Kansas State University Integrated Genomics Facility.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
sRNAseq of ALG-1 IP
|
| Data processing |
Small RNAseq reads were checked for quality before and after filtering using FastQC v0.11.8 (https://www.bioinformatics.babraham.ac.uk/projects/fastqc).
Cutadapt tool was used to clip the adapter sequence from 3’ end (-a ATCTCGTATGCCGTCTTCTGCTTG -e 0.1).
Reads were split into libraries using fastx barcode splitter utility (http://hannonlab.cshl.edu/fastx_toolkit/index.html) and the remaining 3’ end and 5’ adapter sequences were clipped.
The randomers were trimmed and the reads with a final length range of 17-29 nt were selected for further analysis.
Reads were mapped to C. elegans genome (WS279) using bowtie v1.2.2 (7, 8) allowing three mismatches in the alignment.
Mature miRNA expression was quantified using the miRDeep2 pipeline (9).
The DESeq2 package in R was used to perform differential expression analysis
Assembly: WS279
Supplementary files format and content: xlsx
|
| |
|
| Submission date |
Dec 26, 2023 |
| Last update date |
Dec 30, 2023 |
| Contact name |
Ye Duan |
| E-mail(s) |
ye.duan@umassmed.edu
|
| Phone |
6178176037
|
| Organization name |
Umass Medical School
|
| Lab |
Victor Ambros
|
| Street address |
373 Plantation Street, Biotech Two, Suite 306
|
| City |
Worcester |
| State/province |
MA |
| ZIP/Postal code |
01605 |
| Country |
USA |
| |
|
| Platform ID |
GPL19757 |
| Series (2) |
| GSE252064 |
Modeling neurodevelopmental disorder-associated human AGO1 mutations in C. elegans Argonaute alg-1. [smallRNA-Seq] |
| GSE252066 |
Modeling neurodevelopmental disorder-associated human AGO1 mutations in C. elegans Argonaute alg-1. |
|
| Relations |
| BioSample |
SAMN39129023 |
| SRA |
SRX23029373 |
