 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 03, 2024 |
| Title |
Prime editing of IL2RB Exon1 after activation of IL2RB in K562 (Rep1) |
| Sample type |
SRA |
| |
|
| Source name |
K562
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: K562
cell type: lymphoblast
genotype: dCas9-VP64
treatment: K562 CRISPRa IL2RB
|
| Treatment protocol |
Transfections of K562 cells were performed using a Lonza Bioscience 4D-Nucleofector system and the SF Cell Line 4D-Nucleofector X kits (Lonza). For single nucleocuvettes (100 uL), 1-2 x 106 cells were transfected with up to 4 ug DNA. For 96-well Nucleocuvette plates (20 uL), 2 x 105 ~ 5 x 105 cells were transfected with up to 2 ug DNA. Program code was FF-120. CRISPRa experiments (K562): On Day 0, 4 x 105 K562 dCas9-VP64 cells were transfected with PB-CMV-MCP-XTEN80-p65-Rta-3xNLS-P2A-T2A-mPlum (600 ng) and paired pU6-Sp-gRNA-2XMS2 (200 ng each) plasmids targeting the same promoter. On Day 2, 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820) or PB-UCOE-EF1a-PE2max-P2A-mCherry-PGK-Blast (800 ng) and the pU6-Sp-pegRNA plasmids (400 ng). All transfections were performed using the SF Cell Line 96-well Nucleofector Kit (Lonza) with program FF-120. Cells transfected with PB-UCOE-EF1a-PE2max-P2A-mCherry-PGK-Blast were selected with 2 ug/mL Puromycin 24 hours after transfection for 2 days. Cells were lysed at Day 5 or 6 for gDNA collection. CRISPRa experiments (WTC11): On Day 0, 2 x 105 the DHFR-dCas9-VPH WTC11 cells were transfected with PB-CMV-MCP-XTEN80-p65-Rta-3xNLS-P2A-T2A-mPlum (2100 ng) and paired pU6-Sp-gRNA-2XMS2 (700 ng each) plasmids targeting the same promoter. 20 uM Trimethoprim was added to induce dCas9-VPH. On Day 3, 2 x 105 cells from the previous transfection were transfected with PB-UCOE-EF1a-PE2max-P2A-mCherry-PGK-Blast (2000 ng) and the pU6-Sp-pegRNA plasmids (1000 ng). All transfections were performed using the P3 Prime Cell 96-well Nucleofector Kit (Lonza) with program CB-150. Cells were continued to be treated with 20 uM Trimethoprim and were selected with 2 ug/mL Puromycin 24 hours after transfection for 1 day. Cells were lysed at Day 5 or 6 for gDNA collection.
|
| Growth protocol |
K562 cells (CCL-243) were purchased from ATCC and maintained in RPMI 1640 medium (Gibco) supplied with 10% FBS (Hyclone) and penicillin/streptomycin (Gibco, 100 U/ mL). The DHFR-dCas9-VPH (VP48-P65-HSF1) WTC11 (human iPSCs) line was generated by the Martin Kampmann lab (Tian et al. 2021). Cells were maintained on Geltrex (Gibco) coated plates in the mTeSR Plus medium (STEMCELL Technologies) supplied with 10 uM Y-27632 (Stemgent). 20 uM trimethoprim was added to culture for stabilization of dCas9-VPH. All cells were kept in a humidified incubator at 37 oC, 5% CO2.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
K562 and WTC11 cells were lysed in a lysis buffer [100 mM Tris-HCl pH8.0, 0.05% SDS and 0.04 mg/mL proteinase K(Thermo Scientific)], and incubated at 50 oC 60 min and 80 oC 30 min.
T7-assisted reporter mapping: gDNA of K562 cells was purified using the DNeasy Blood & Tissue Kit (QIAGEN) and in vitro transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs). Briefly, each reaction (20 uL) contained 0.3~1 ug gDNA, NTPs (10 mM each) and 2 ul T7 RNA Polymerase Mix. The reaction mixture was incubated at 37 oC for 16 hours. Then, gDNA was digested with 2.5 uL DNase (Qiagen) in a 100 uL reaction at room temperature for 30 min. RNA was extracted with TRIzol LS Reagent (Invitrogen), and aqueous phase was precipitated with 1 volume of isopropanol and 5 ug Glycogen (Invitrogen) at -80 oC for 1 hour. RNA pellet was collected by centrifugation at 21,000 x g at 4 oC for 1 hour. The pellet was washed with 80% ice-cold ethanol and resuspended in 11.5 uL nuclease-free water. For reverse transcription, RNA was incubated with 0.5 uL 100 uM RT primer p6 (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNN-3’) and 1 uL 10 mM dNTP at 65 oC for 5 min and cooled on ice. Then, 4 uL 5X RT buffer, 1 uL 100 mM DTT, 1 uL RNaseOUT (40 U/uL) and 1 uL SuperScript IV RT (200 U/uL, Invitrogen) were added and the reaction mixture was incubated at 23 oC for 10 min, 50 oC for 15 min and 80 oC for 10 min. cDNA library was amplified with KAPA2G Robust HotStart polymerase, using primers p7 (5’- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAAAGGAAGCCCTGCTTCCTCCAGAGGG-3’, 0.5 uM) and p8 (5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’, 0.5 uM). PCR reaction was performed as follows: 95 oC 3 min; 95 oC 15 s, 65 oC 15 s, 72 oC 30 s, 16~18 cycles; and 72 oC 1 min. The PCR product was subjected to double-sided size selection (0.5X, 0.9X) and cleaned up with AMPure XP beads. The resulting product ranged from 200 to 1000 bp. To prepare Illumina sequencing libraries, 5-10 ng PCR product was re-amplified with the Nextera P5 and TruSeq P7 library index primers for 5 cycles. The final PCR product underwent another round of double-sided size selection (0.5X, 0.9X) and cleaned up with AMPure XP beads. The library was sequenced on an Illumina MiSeq in paired-end mode (Read 1: 254 bp; Read2: 55bp). Amplicon sequencing of synHEK3 reporters: 100~250 ng gDNA or cell lysates were amplified using KAPA2G Robust HotStart ReadyMix with primers p9 (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCCCGACCACATGAAGCAGC-3’, 0.5 uM) and p10 (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNGACCATGTCATCGCGCTTCTCGT-3’, 0.5 uM). PCR reaction was performed as follows: 95 oC 3 min; 95 oC 15 s, 68-N oC 15 s, 72 oC 30 s, for 9 cycles (N was cycle number); 95 oC 15 s, 65 oC 15 s, 72 oC 30 s, for 11 cycles; and 72 oC 1 min. To ensure enough coverage and accurate measurement of editing efficiencies, for the K562 synHEK3 pool, we pooled products from at least 16 PCR reactions. The PCR product was purified with AMPure XP beads. 5 ng PCR product was re-amplified with the Nextera P5 and TruSeq P7 library index primers for 5 cycles. Other amplicon sequencing: Cell lysates or plasmids were directly used for PCR with the KAPA2G Robust HotStart ReadyMix with primers (0.5 uM each) designed for the endogenous targets. PCR reaction was performed as follows: 95 oC 3 min; 95 oC 15 s, 66-N oC 15 s, 72 oC 40 s, for 8 cycles (N was cycle number); 95 oC 15 s, 60 oC 15 s, 72 oC 40 s, for 11 cycles; and 72 oC 1 min. The PCR product was purified with AMPure XP beads. 5 ng PCR product was re-amplified with the Nextera P5 and TruSeq P7 library index primers for 5 cycles.
Amplicon sequencing
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
Amplicon sequencing of engogenous genes
|
| Data processing |
T7-assisted reporter mapping: Sequencing reads were first demultiplexed using the bcl2fastq software. Under the current library design and sequencing scheme, Read1 started from genomic sequence and extended into the integrated synHEK3 construct, while Read2 contained reporter barcode information. Therefore, 1) for each sequencing read pair, the 16-bp reporter barcode was extracted from Read 2 and attached to the read name of Read 1. 2) Read1 was trimmed using cutadapt (v4.1) with following parameters: --cores=4 --discard-untrimmed -e 0.2 -m 10 -O 8 -a CCCTAGAAAGATAGTCTGCGTAAAATTGACGCATG. The adapter corresponded to the 3’ITR of piggyBac transposon. Since parameter “--discard-untrimmed” was used, only reads spanning insertion junctions were kept and trimmed. 3) Trimmed sequences were aligned to the GRCh38 reference genome using bwa mem (v0.7.17). The “-Y” option was used to enable soft clipping for supplementary alignments. 4) Reads uniquely (without XA:Z tag) and contiguously mapped near putative piggyBac landing pads (TTAA motifs) were kept using samtools (v1.9) and a custom script. 5) Aligned reads were converted to BED format using the sam2bed function in bedops (v2.4.35). Reads aligned to standard chromosomes were kept. 6) Insertion points were calculated for all reads based on strand of alignment. And reads were sorted by the insertion coordinates. 7) The first 8-bp of reads were used as UMIs. A custom script was used to collapse reads at a per-location, per-barcode, per UMI basis. A barcode-location-UMI count table was generated. 8) synHEK3 barcodes <3 Levenshtein Distance at each location were collapsed and barcodes with > 3 UMIs were kept. 9) The count table was converted to a GenomicRanges object in R. Coordinates of the last 4 base pairs of aligned reads were designated as genomic locations of the inserted synHEK3 reporters. 10) “Landing pads” of the mapped synHEK3 reporters were retrieved using the getSeq() function in the BSgenome package. Reporters that didn’t have a TTAA sequence (which could be due to PCR error, mapping error, or the use of non-canonical landing pads) were removed. 11) SynHEK3 barcodes mapped to more than one location were removed.
SynHEK3 amplicon sequencing library: Sequencing reads from the Illumina NextSeq platforms were first demultiplexed using the bcl2fastq software. The 16-bp reporter barcodes were extracted from read and attached to its read name. Sequences around the CRISPR cut site were extracted for all reads. A barcode-editing outcome table was generated. For prime editing experiments, a custom script was used to align sequences to a reference sequence and count mutation frequency for every barcode. For Cas9 mutagenesis analysis, all sequences were aggregated and editing outcomes (alleles) with the highest number of counts were selected. These most frequent alleles were then aligned to reference sequences using needleall with the following parameters: -gapopen 20 -gapextend 0.5 -endopen 20. A custom script was used to annotate the mutational events.
Amplicon sequencing of endogenous genes: Sequencing reads were demultiplexed using the bcl2fastq software (Illumina). A custom script was used to determine frequencies of the introduced substitutions.
Assembly: GRCh38
Supplementary files format and content: CRISPRa_K562_new.csv contains editing efficiencies in the CRISPRa experiments in K562 cells
Supplementary files format and content: CRISPRa_WTC11_new.csv contains editing efficiencies in the CRISPRa experiments in WTC11 cells
Supplementary files format and content: PE2max_endogenous_121_K562.csv contains editing efficiencies of the 121 epegRNAs in K562 cells
Supplementary files format and content: PE_IL2RB_libraries.csv contains corrected editing efficiencies of epegRNA pools targeting IL2RB (with and without CRISPR activation of IL2RB)
Supplementary files format and content: T7-WT-Pool1.csv contains mapped locations, editing outcomes, and chromatin scores of synHEK3 reporters in wild-type K562 cells
Supplementary files format and content: T7-WT-Pool2.csv contains mapped locations, editing outcomes, and chromatin scores of synHEK3 reporters in wild-type K562 cells
|
| |
|
| Submission date |
Jan 02, 2024 |
| Last update date |
Jan 03, 2024 |
| Contact name |
Xiaoyi Li |
| E-mail(s) |
xyli10@uw.edu
|
| Organization name |
University of Washington
|
| Department |
Department of Genome Sciences
|
| Lab |
Jay Shendure
|
| Street address |
3720 15th Ave NE
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98195 |
| Country |
USA |
| |
|
| Platform ID |
GPL30173 |
| Series (2) |
| GSE228463 |
Chromatin context-dependent regulation and modulation of prime editing [amplicon] |
| GSE228465 |
Chromatin context-dependent regulation and epigenetic modulation of prime editing |
|
| Relations |
| BioSample |
SAMN39224390 |
| SRA |
SRX23075131 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
