|
Status |
Public on Jun 27, 2024 |
Title |
hpGUS[G:U]_2 |
Sample type |
SRA |
|
|
Source name |
leaf
|
Organism |
Nicotiana tabacum |
Characteristics |
tissue: leaf genotype: W38
|
Growth protocol |
tobacco plants were grown under long day condiitions and leaf material collected for sequencing
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was extracted using trizol NEBNext® Small RNA Library Prep libraries sequenced on a Novaseq
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
hpGUS[G:U] rep 1
|
Data processing |
Reads were trimmed using cut adapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --minimum-length=15 Trimmed reads were mapped to the tobacco genome, GUS gene and sense strand of the stem of asymmetric bulge hairpins Reads were mapped using Bowtie 1.3.1 with options -v 0 -a --best --strata -l 18 awk commands were used to filter out reads mapping to GUS with only unique reads retained for downstream analysis Assembly: GCA_002210045.1_Nitab4.5_genomic.fna Supplementary files format and content: raw files are in fastq format Supplementary files format and content: processed files are unique reads mapped to the GUS gene in a .bed format. Rows are 1 = mapping to GUS or asymmetric bulge sense strands; 2 = Start; 3= End; 4 = read name; 5 = quality; 6 = strand; 7 = sRNA size
|
|
|
Submission date |
Jan 10, 2024 |
Last update date |
Jun 27, 2024 |
Contact name |
Ian K Greaves |
E-mail(s) |
ian.greaves@csiro.au
|
Phone |
61 6246 4828
|
Organization name |
csiro
|
Street address |
clunies ross street
|
City |
Acton |
State/province |
act |
ZIP/Postal code |
2601 |
Country |
Australia |
|
|
Platform ID |
GPL23495 |
Series (2) |
GSE243297 |
Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence |
GSE252890 |
Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence [RNA-Seq] |
|
Relations |
BioSample |
SAMN39327926 |
SRA |
SRX23148100 |