NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM8009866 Query DataSets for GSM8009866
Status Public on Jun 27, 2024
Title hpGUS[G:U]_2
Sample type SRA
 
Source name leaf
Organism Nicotiana tabacum
Characteristics tissue: leaf
genotype: W38
Growth protocol tobacco plants were grown under long day condiitions and leaf material collected for sequencing
Extracted molecule total RNA
Extraction protocol RNA was extracted using trizol
NEBNext® Small RNA Library Prep
libraries sequenced on a Novaseq
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description hpGUS[G:U] rep 1
Data processing Reads were trimmed using cut adapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --minimum-length=15
Trimmed reads were mapped to the tobacco genome, GUS gene and sense strand of the stem of asymmetric bulge hairpins
Reads were mapped using Bowtie 1.3.1 with options -v 0 -a --best --strata -l 18
awk commands were used to filter out reads mapping to GUS with only unique reads retained for downstream analysis
Assembly: GCA_002210045.1_Nitab4.5_genomic.fna
Supplementary files format and content: raw files are in fastq format
Supplementary files format and content: processed files are unique reads mapped to the GUS gene in a .bed format. Rows are 1 = mapping to GUS or asymmetric bulge sense strands; 2 = Start; 3= End; 4 = read name; 5 = quality; 6 = strand; 7 = sRNA size
 
Submission date Jan 10, 2024
Last update date Jun 27, 2024
Contact name Ian K Greaves
E-mail(s) ian.greaves@csiro.au
Phone 61 6246 4828
Organization name csiro
Street address clunies ross street
City Acton
State/province act
ZIP/Postal code 2601
Country Australia
 
Platform ID GPL23495
Series (2)
GSE243297 Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence
GSE252890 Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence [RNA-Seq]
Relations
BioSample SAMN39327926
SRA SRX23148100

Supplementary file Size Download File type/resource
GSM8009866_GU2_GUS_unique.bed.gz 2.1 Mb (ftp)(http) BED
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap