 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 26, 2024 |
| Title |
A549 cells infected with ZIKV WT replicate 1 RNA-seq |
| Sample type |
SRA |
| |
|
| Source name |
A549 cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A549 cells
cell type: lung carcinoma epithelial cells
genotype: WT
treatment: ZIKV WT infected
|
| Treatment protocol |
Infection with ZIKV WT and ZIKV sfRNAnull
|
| Growth protocol |
ZIKV infections were conducted using A549 cells (human epithelial lung cell line). A549 cells were cultured in Dulbecco's modified Eagle's medium with nutrient mixture F-12 (DMEM/F-12) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
In brief, ribosome protected fragments were collected from duplicate samples of A549 cells infected with ZIKV wild type or sFRNAnull mutant at 20 hpi. A p100 dish of A549 cells was incubated with cycloheximide (0.1 μg/ml) in PBS for 5 minutes. The PBS was removed, and the cells were treated with Lysis buffer (20 mM total Tris HCL pH 8.0; 140 mM KCl; 1.5 mM MgCl2; 100 μg/ml Cycloheximide; 1% Triton; 40 U/ml SUPERas In (Ambion #AM2694); 10 μl/ml Protease Inhibitor Cocktail (Calbiochem #535140-1ML)). The mix was clarified for 10 minutes at 10,000g at 4°C. RNase I (100 Units, Ambion #AM2295) and DNase (10 Units, Ambion #AM2238) were added to the supernatant and incubated at room temperature for 45 minutes with gentle mixing. Digested extracts (50 μl) were then overlaid onto s-40 columns following the manufacturer’s instructions. RNA was extracted using Trizol (Invitrogen, #800868). RNA for each sample for RNA-seq was collected in parallel with the Ribosome profile experiment for RNA preparation. RNA was extracted using Trizol (Invitrogen, #800868).
Ribosome protected fragments (RPF) were separately excised in a 15% urea gel from 28-to-38 nucleotides. RNA was eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/μl SUPERas In (Ambion #AM2694), followed by ethanol precipitation. RFP were 3’-dephosphorylated with polynucleotide kinase (10 U, PNK, New England Biolabs) in T4 polynucleotide kinase buffer (without ATP) for 1 h at 37°C, followed by a 10 min incubation at 75°C and ethanol precipitation. All RNA samples were resuspended and ligated to 3’ adaptor (30 μM /5rApp/ATCTCGTATGCCGTCTTCTGCTTG/3ddC/) using T4 RNA Ligase 2, truncated K227Q (2 U, New England Biolabs; #M0351S) and RNAseOUT Recombinant Ribonuclease Inhibitor (5 U, Invitrogen, #10777-019) for 6 h at 20°C. Ligation reactions were separately in a 10% urea gel, and fragments from 50-to-65 nucleotides for the RPF and 50-to-75 nucleotides were excised, eluted, and precipitated from the gel. The 3’-ligation products were then 5’-phosphorylated with polynucleotide kinase (15 U, PNK, New England Biolabs) in T4 polynucleotide kinase buffer supplemented with 1 mM ATP for 30 minutes at 37°C followed by RNA precipitation in ethanol. The 5’-ligation was performed using T4 RNA Ligase 1 (ssRNA Ligase, 10 U New England Biolabs, #M0204S) for 6 hrs at 20°C with barcoded 5´-Adaptor (100 μM, GUUCAGAGUUCUACAGUCCGACGAUCAAAC; GUUCAGAGUUCUACAGUCCGACGAUCGGGC; GUUCAGAGUUCUACAGUCCGACGAUCUUUC; GUUCAGAGUUCUACAGUCCGACGAUCCCCC; GUUCAGAGUUCUACAGUCCGACGAUCACUC; GUUCAGAGUUCUACAGUCCGACGAUCGACC; GUUCAGAGUUCUACAGUCCGACGAUCUGAC; GUUCAGAGUUCUACAGUCCGACGAUCCUGC). The 5’-ligation reactions were separately in a 10% urea gel, and the region from 80-to-95 nucleotides for the RPFs and 80-to-105 nucleotides for the RNA input samples was excised, eluted, and precipitated from the gel. Gel-purified samples were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen) with RTOligo (CAAGCAGAAGACGGCATACGA) according to the manufacturer (Invitrogen). Amplification was done using Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and oligos: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA and CAAGCAGAAGACGGCATACGA. PCR was carried out with an initial 30 s denaturation at 98°C, followed by 4 cycles of 30 s denaturation at 98°C, and 15 s extension at 72°C. Followed by 10- 15 cycles of 10 s denaturation at 98°C, 30 s annealing at 50°C, and 15 s extension at 72°C. Several reactions, with different numbers of cycles, were performed. Reactions were separated on a non-denaturing 8% polyacrylamide TBE gel, and DNA fragments of the correct size were extracted and sequenced using Illumina HiSeq2000.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 2000 |
| |
|
| Data processing |
RiboSeeker 0.0.1.0
Adapter sequence was trimmed using FASTX Toolkit (0.0.14), and we only keep reads with length between 20bp and 40bp
We map the filtered reads to a set of ncRNAs using bowtie2 (2.4.2)
We take the reads that are not mapped to ncRNAs and further align them to the reference genome using STAR (2.7.3a)
Genomic feature stats (CDS, UTR, intron, intergenic, and ribosome) are generated using Picard tools (2.25.7)
Assembly: hg38
Supplementary files format and content: Tab-separated values. Total raw read and labeled read counts for all samples including read counts mapped to viral genome (MT636065)
|
| |
|
| Submission date |
Jan 25, 2024 |
| Last update date |
Apr 26, 2024 |
| Contact name |
Horacio Martín Pallarés |
| E-mail(s) |
homar.palla@gmail.com
|
| Phone |
+5491158789299
|
| Organization name |
Fundación instituto leloir
|
| Lab |
Laboratorio de virología
|
| Street address |
Av patricias argentinas 435
|
| City |
Ciudad de Buenos Aires |
| ZIP/Postal code |
1405 |
| Country |
Argentina |
| |
|
| Platform ID |
GPL30173 |
| Series (2) |
| GSE254252 |
Zika Virus Non-Coding RNAs Antagonize Antiviral Responses by PKR-Mediated Translational Arrest (RNA-Seq) |
| GSE254254 |
Zika Virus Non-Coding RNAs Antagonize Antiviral Responses by PKR-Mediated Translational Arrest |
|
| Relations |
| BioSample |
SAMN39613179 |
| SRA |
SRX23396273 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8036801_A549_ZIKV1.rna.ReadsPerGene.out.tab.gz |
295.6 Kb |
(ftp)(http) |
TAB |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
