 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 29, 2024 |
| Title |
dsDNase_artificial_R_loop |
| Sample type |
SRA |
| |
|
| Source name |
artificial R-loop
|
| Organism |
synthetic construct |
| Characteristics |
cell line: artificial R-loop
|
| Extracted molecule |
other |
| Extraction protocol |
To prepare half R-loop substrates, RNA (5’-GGGAUGGUGCUGGACUCAUUCGGCAUCGGCGCUACAGAAGAUGCAGAACGCUUUGGUGACGUCGGGGCUGACACCCUGGGUCAUAUCGCAGAAGCUUGUGCCAAAGGCGAAGCUGAUAACGGUCGUAAAGGCCCGCUCAAUCUGCCAAAUCUGACCCGUCUGGGGCUGGCGAAAGCACACGAAGGUUCUACCGGUUUCAUUCC-3’) was produced by using in vitro transcription kit (New England Biolabs; M0658) and purified with phenol-chloroform method. In the following reverse transcription step, PCR templates was removed by gDNA digester (YEASEN; 11141ES10), followed by cDNA synthesis with primer (5’-ACGTGTCATGACTGACACTGGCAGTACGTAGCAGTGGTAGAACCTTCGTGTGC-3’) and paired DNA oligo (5’-TTCTACCACGGAACTGCTACGTACTGCCAGTGTCAGTCATGACACGT-3’). following the protocol (YEASEN; 11141ES10). The artificial R-loop was purified by 2 volumes of SPRIselect beads. 10 ng purified artificial R-loop was mixed with 20 U mung bean nuclease, S1 nuclease, dsDNase, dsDNA Fragmentase respectively, and incubated at 37°C for 10 min. The digested product was purified using 1.8 volumes of SPRIselect beads. Purified product was DRIPed and used for ssDNA library construction as described previously (ssDRIP-seq, Xu et al., 2017). The library was sequenced on an Illumina NovaSeq system.
|
| |
|
| Library strategy |
OTHER |
| Library source |
other |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
bigWig
Supplementary files format and content: bigWig
Library strategy: ssDRIP-seq
|
| |
|
| Submission date |
Feb 21, 2024 |
| Last update date |
May 29, 2024 |
| Contact name |
li kuan |
| E-mail(s) |
likuan@cibr.ac.cn
|
| Organization name |
Tsinghua University
|
| Street address |
zhongguancun
|
| City |
Beijing |
| ZIP/Postal code |
100084 |
| Country |
China |
| |
|
| Platform ID |
GPL26526 |
| Series (1) |
| GSE183453 |
R-loop landscapes during parental-to-zygotic transition in zebrafish |
|
| Relations |
| BioSample |
SAMN40014349 |
| SRA |
SRX23679371 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8091638_dsDNase_artificial_R_loop_1stbase_fwd.bw |
1.4 Kb |
(ftp)(http) |
BW |
| GSM8091638_dsDNase_artificial_R_loop_1stbase_rev.bw |
1.4 Kb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
