NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM8091639 Query DataSets for GSM8091639
Status Public on May 29, 2024
Title dsFragmentase_artificial_R_loop
Sample type SRA
 
Source name artificial R-loop
Organism synthetic construct
Characteristics cell line: artificial R-loop
Extracted molecule other
Extraction protocol To prepare half R-loop substrates, RNA (5’-GGGAUGGUGCUGGACUCAUUCGGCAUCGGCGCUACAGAAGAUGCAGAACGCUUUGGUGACGUCGGGGCUGACACCCUGGGUCAUAUCGCAGAAGCUUGUGCCAAAGGCGAAGCUGAUAACGGUCGUAAAGGCCCGCUCAAUCUGCCAAAUCUGACCCGUCUGGGGCUGGCGAAAGCACACGAAGGUUCUACCGGUUUCAUUCC-3’) was produced by using in vitro transcription kit (New England Biolabs; M0658) and purified with phenol-chloroform method. In the following reverse transcription step, PCR templates was removed by gDNA digester (YEASEN; 11141ES10), followed by cDNA synthesis with primer (5’-ACGTGTCATGACTGACACTGGCAGTACGTAGCAGTGGTAGAACCTTCGTGTGC-3’) and paired DNA oligo (5’-TTCTACCACGGAACTGCTACGTACTGCCAGTGTCAGTCATGACACGT-3’). following the protocol (YEASEN; 11141ES10). The artificial R-loop was purified by 2 volumes of SPRIselect beads. 10 ng purified artificial R-loop was mixed with 20 U mung bean nuclease, S1 nuclease, dsDNase, dsDNA Fragmentase respectively, and incubated at 37°C for 10 min. The digested product was purified using 1.8 volumes of SPRIselect beads. Purified product was DRIPed and used for ssDNA library construction as described previously (ssDRIP-seq, Xu et al., 2017). The library was sequenced on an Illumina NovaSeq system.
 
Library strategy OTHER
Library source other
Library selection other
Instrument model Illumina NovaSeq 6000
 
Data processing bigWig
Supplementary files format and content: bigWig
Library strategy: ssDRIP-seq
 
Submission date Feb 21, 2024
Last update date May 29, 2024
Contact name li kuan
E-mail(s) likuan@cibr.ac.cn
Organization name Tsinghua University
Street address zhongguancun
City Beijing
ZIP/Postal code 100084
Country China
 
Platform ID GPL26526
Series (1)
GSE183453 R-loop landscapes during parental-to-zygotic transition in zebrafish
Relations
BioSample SAMN40014350
SRA SRX23679372

Supplementary file Size Download File type/resource
GSM8091639_dsFragmentase_artificial_R_loop_1stbase_fwd.bw 1.4 Kb (ftp)(http) BW
GSM8091639_dsFragmentase_artificial_R_loop_1stbase_rev.bw 1.4 Kb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap