![](/coreweb/template1/pix/main_left_bg.gif) |
![](/coreweb/template1/pix/pixel.gif) |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on May 29, 2024 |
Title |
dsFragmentase_artificial_R_loop |
Sample type |
SRA |
|
|
Source name |
artificial R-loop
|
Organism |
synthetic construct |
Characteristics |
cell line: artificial R-loop
|
Extracted molecule |
other |
Extraction protocol |
To prepare half R-loop substrates, RNA (5’-GGGAUGGUGCUGGACUCAUUCGGCAUCGGCGCUACAGAAGAUGCAGAACGCUUUGGUGACGUCGGGGCUGACACCCUGGGUCAUAUCGCAGAAGCUUGUGCCAAAGGCGAAGCUGAUAACGGUCGUAAAGGCCCGCUCAAUCUGCCAAAUCUGACCCGUCUGGGGCUGGCGAAAGCACACGAAGGUUCUACCGGUUUCAUUCC-3’) was produced by using in vitro transcription kit (New England Biolabs; M0658) and purified with phenol-chloroform method. In the following reverse transcription step, PCR templates was removed by gDNA digester (YEASEN; 11141ES10), followed by cDNA synthesis with primer (5’-ACGTGTCATGACTGACACTGGCAGTACGTAGCAGTGGTAGAACCTTCGTGTGC-3’) and paired DNA oligo (5’-TTCTACCACGGAACTGCTACGTACTGCCAGTGTCAGTCATGACACGT-3’). following the protocol (YEASEN; 11141ES10). The artificial R-loop was purified by 2 volumes of SPRIselect beads. 10 ng purified artificial R-loop was mixed with 20 U mung bean nuclease, S1 nuclease, dsDNase, dsDNA Fragmentase respectively, and incubated at 37°C for 10 min. The digested product was purified using 1.8 volumes of SPRIselect beads. Purified product was DRIPed and used for ssDNA library construction as described previously (ssDRIP-seq, Xu et al., 2017). The library was sequenced on an Illumina NovaSeq system.
|
|
|
Library strategy |
OTHER |
Library source |
other |
Library selection |
other |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Data processing |
bigWig Supplementary files format and content: bigWig Library strategy: ssDRIP-seq
|
|
|
Submission date |
Feb 21, 2024 |
Last update date |
May 29, 2024 |
Contact name |
li kuan |
E-mail(s) |
likuan@cibr.ac.cn
|
Organization name |
Tsinghua University
|
Street address |
zhongguancun
|
City |
Beijing |
ZIP/Postal code |
100084 |
Country |
China |
|
|
Platform ID |
GPL26526 |
Series (1) |
GSE183453 |
R-loop landscapes during parental-to-zygotic transition in zebrafish |
|
Relations |
BioSample |
SAMN40014350 |
SRA |
SRX23679372 |
Supplementary file |
Size |
Download |
File type/resource |
GSM8091639_dsFragmentase_artificial_R_loop_1stbase_fwd.bw |
1.4 Kb |
(ftp)(http) |
BW |
GSM8091639_dsFragmentase_artificial_R_loop_1stbase_rev.bw |
1.4 Kb |
(ftp)(http) |
BW |
SRA Run Selector![Help](/coreweb/images/long_help4.gif) |
Raw data are available in SRA |
|
|
|
|
![](/coreweb/template1/pix/main_right_bg.gif) |