 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 26, 2024 |
| Title |
Cattle, AVITI, csRNA-seq, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Blood
|
| Organism |
Bos taurus |
| Characteristics |
tissue: Blood
|
| Growth protocol |
A375 and BT474 cells were grown at 37°C with 5% CO2 in DMEM (Cellgro) supplemented with 10% FBS (Gibco), and 50 U Penicillin and 50 μg Streptomycin per mL (Gibco). Cattle and bison samples were obtained from experimental animals housed at Washington State University, Pullman, WA and University of Wyoming, Laramie WY, respectively. 2.8 ml blood was collected from healthy animals using PAXgene Blood RNA tubes (BD Bioscience) by venipuncture (jugular) and transported on ice to the laboratory for processing.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were washed once with ice cold DPBS (Gibco), rested on ice for 5 minutes, washed one more time with ice cold DPBS and then lysed in 1 ml TROZOL. RNA isolated as described by the manufacturer.
csRNA-seq was performed as described in (S. H. Duttke et al. 2019). Small RNAs of ~20-60 nt were size selected from 0.4-3 µg of total RNA by denaturing gel electrophoresis. A 10% input sample was taken aside and the remainder enriched for 5'-capped RNAs. Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5'-Phosphate-Dependent Exonuclease (Lucigen). Subsequently, RNAs were 5'dephosphorylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark. Input (sRNA) and csRNA-seq libraries were prepared as described in (Hetzel et al. 2016) using RppH (NEB) and the NEBNext Small RNA Library Prep kit, amplified for 11-14 cycles.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Element AVITI |
| |
|
| Description |
short RNAs (20-65nt)
Cloudbreak_FreeStyle
Bos_taurus-Blood_AVITI.reps.merged.tss.txt
|
| Data processing |
Reads were trimmed of their adapter sequences using HOMER (homerTools trim -3 AGATCGGAAGAGCACACGTCT -mis 2 -minMatchLength 4 -min 20).
Reads were subsampled using SeqKit's sample v2.5.1 to acheieve equal read depth.
Reads were aligned to the the appropriate reference genome using STAR v2.7.10a for humans and Hisat2 v2.2.1 for the livestock.
Alignment files were converted to tag directories using HOMER2 batchMakeTagDirectory.pl.
BedGraph files were generated from the tag directories using makeUCSCfile.
Peaks representing Transcription Start Regions (TSRs) for csRNA-seq and expressed small RNAs for sRNA-seq, were defined using HOMER’s findcsRNATSR.pl and findPeaks, respectively. A minimum read count of 10 per 10 million was required for regions to be considered.
Assembly: hg38, GCF_002263795.2, modified_GCA_018282365.1
Supplementary files format and content: BedGraph files (.bedGraph.gz) containing the locations that denote TSS positions.
Supplementary files format and content: Text files (.tss.txt) containing tab-delimited data on identified transcription start site clusters (TSRs).
Supplementary files format and content: Modified gtf file that underwent an ID update to achieve consistency with the fasta genome.
Library strategy: csRNA-seq
|
| |
|
| Submission date |
May 20, 2024 |
| Last update date |
Jun 26, 2024 |
| Contact name |
Sascha Duttke |
| Organization name |
Washington State University
|
| Department |
School of Molecular Biosciences
|
| Lab |
Dr. Duttke Lab
|
| Street address |
BLS 147, 100 Dairy Road
|
| City |
Pullman |
| State/province |
Washington |
| ZIP/Postal code |
99164 |
| Country |
USA |
| |
|
| Platform ID |
GPL34487 |
| Series (1) |
| GSE267848 |
Efficient small DNA fragment sequencing and miRNA, small RNA or csRNA-seq libraries using AVITI |
|
| Relations |
| BioSample |
SAMN41455486 |
| SRA |
SRX24605994 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8279802_Bos_taurus-Blood_AVITI_csRNA-r2.bedGraph.gz |
7.1 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
