strain: BS-90 developmental stage: 4-8mm experimental variable: injected with GFP specific DSiRNA oligos and exposed to S. mansoni miracidia 2 hours later
Treatment protocol
B. glabrata snails were injected with a 10ul cocktail containing 200ng of DSiRNA oligos specific to either FREP3 or GFP. Two hours later, the snails were placed in well plates with artificial spring water and exposed to 30 S. mansoni miricidia for 24 hours on day 0. After 24 hours, they were placed into aquaria for the remainder of the experiment. On day 2 and 4 post-exposure, ten snails from each group were collected for analysis using the snail array. Other controls in this experiment include uninjected BS-90's and M-line snails both exposed to S. mansoni miracidia at the same time as the other two groups, but these were not examined using the microarray.
Growth protocol
Snails and trematodes used in this study were maintained at the University of New Mexico
Extracted molecule
total RNA
Extraction protocol
Total RNA was extracted using Trizol and the RNA mini kit from Ambion with an on-column DNAse procedure as described in the manual.
Label
Cy3
Label protocol
Complementary DNA was synthesized, amplified, labeled and hybridized using the modified SMART (Clontech) cDNA labeling protocol described by Petalidis and colleagues. Briefly, 300 ng total RNA were mixed with 3 µL of 10 μM 3′ SMART CDS primer IIA (5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 3 µL 10 μM template switching primer (5′-d(AAGCAGTGGTATCAACGCAGAGTACGC)r(GGG)-3′) and brought to a final volume of 15 µL with RNase free dH2O. The template switching primer is a DNA:RNA hybrid where the last 3 bases are RNA. The reaction was then incubated at 72°C for 2 min and then placed on ice. Six microliters of 5x first-strand buffer (Clontech), 3 µL DTT (20 mM), 3 µL dNTPs (10 mM), and 3 µL and PowerScriptTM reverse transcriptase (Clontech) were then added to the reaction and the mixture incubated at 42°C for 1.0 h to generate first strand cDNA. Second-strand cDNA was then amplified by mixing 15 µL of the first-strand cDNA reaction with 57 µL dH2O, 10 µL 10x PCR buffer II (Applied Biosystems), 10 µL 25 mM MgCl2, 2 µL 10 mM dNTPs, 4 µL 10 μM 5’ PCR primer (5′-AAGCAGTGGTATCAACGCAGAGT-3′) and 2 µl AmpliTaq® (40 U/µL). Amplification conditions were 95°C for 1 min for one cycle followed by 95°C for 5 s, 65°C for 5 s, and 68°C for 6 min for 15 cycles. Second strand cDNA was then purified using a QIAquick® PCR Purification Kit (Qiagen), quantified using a NanoDrop® ND-1000 spectrophotometer and labeled with Cy3/Cy5 d-CTPs (GE Healthcare-Amersham) using BioPrime® DNA Labeling System (Invitrogen). For labeling, 200 ng of second-strand cDNA suspended in 21 µL dH2O was mixed with 20 μL of 2.5x random primer reaction buffer (Invitrogen) and incubated at 95°C for 5 min, then placed on ice. While on ice, 2 µL dH2O, 5 μL low-C dNTP mix (5 mM dATP, 5 mM dGTP, 5 mM dTTP, 2 mM dCTP), 1 µL Cy3 or Cy5 dCTP and 1 μL Klenow enzyme (40 U/µL; Invitrogen) were mixed and incubated at 37°C for 2.0 h. The labeling reaction was stopped by adding 5 μL stop buffer (Invitrogen). For all experiments, reference samples were labeled with Cy3 and experimental samples with Cy5. Cy3 and Cy5 labeled probes were purified separately using an AutoSeqTM G-50 Dye Terminator Removal Kit (GE Healthcare) and labeling efficiency quantified using a NanoDrop® ND-1000 spectrophotometer.
Channel 2
Source name
Biomphalaria glabrata injected with FREP3 specific DSiRNA oligos and 2 hours later exposed to S. mansoni miracidia
strain: BS-90 developmental stage: 4-8mm experimental variable: Injected with FREP3 specific DSiRNA oligos and two hours later exposed to S. mansoni miracidia
Treatment protocol
B. glabrata snails were injected with a 10ul cocktail containing 200ng of DSiRNA oligos specific to either FREP3 or GFP. Two hours later, the snails were placed in well plates with artificial spring water and exposed to 30 S. mansoni miricidia for 24 hours on day 0. After 24 hours, they were placed into aquaria for the remainder of the experiment. On day 2 and 4 post-exposure, ten snails from each group were collected for analysis using the snail array. Other controls in this experiment include uninjected BS-90's and M-line snails both exposed to S. mansoni miracidia at the same time as the other two groups, but these were not examined using the microarray.
Growth protocol
Snails and trematodes used in this study were maintained at the University of New Mexico
Extracted molecule
total RNA
Extraction protocol
Total RNA was extracted using Trizol and the RNA mini kit from Ambion with an on-column DNAse procedure as described in the manual.
Label
Cy5
Label protocol
Complementary DNA was synthesized, amplified, labeled and hybridized using the modified SMART (Clontech) cDNA labeling protocol described by Petalidis and colleagues. Briefly, 300 ng total RNA were mixed with 3 µL of 10 μM 3′ SMART CDS primer IIA (5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 3 µL 10 μM template switching primer (5′-d(AAGCAGTGGTATCAACGCAGAGTACGC)r(GGG)-3′) and brought to a final volume of 15 µL with RNase free dH2O. The template switching primer is a DNA:RNA hybrid where the last 3 bases are RNA. The reaction was then incubated at 72°C for 2 min and then placed on ice. Six microliters of 5x first-strand buffer (Clontech), 3 µL DTT (20 mM), 3 µL dNTPs (10 mM), and 3 µL and PowerScriptTM reverse transcriptase (Clontech) were then added to the reaction and the mixture incubated at 42°C for 1.0 h to generate first strand cDNA. Second-strand cDNA was then amplified by mixing 15 µL of the first-strand cDNA reaction with 57 µL dH2O, 10 µL 10x PCR buffer II (Applied Biosystems), 10 µL 25 mM MgCl2, 2 µL 10 mM dNTPs, 4 µL 10 μM 5’ PCR primer (5′-AAGCAGTGGTATCAACGCAGAGT-3′) and 2 µl AmpliTaq® (40 U/µL). Amplification conditions were 95°C for 1 min for one cycle followed by 95°C for 5 s, 65°C for 5 s, and 68°C for 6 min for 15 cycles. Second strand cDNA was then purified using a QIAquick® PCR Purification Kit (Qiagen), quantified using a NanoDrop® ND-1000 spectrophotometer and labeled with Cy3/Cy5 d-CTPs (GE Healthcare-Amersham) using BioPrime® DNA Labeling System (Invitrogen). For labeling, 200 ng of second-strand cDNA suspended in 21 µL dH2O was mixed with 20 μL of 2.5x random primer reaction buffer (Invitrogen) and incubated at 95°C for 5 min, then placed on ice. While on ice, 2 µL dH2O, 5 μL low-C dNTP mix (5 mM dATP, 5 mM dGTP, 5 mM dTTP, 2 mM dCTP), 1 µL Cy3 or Cy5 dCTP and 1 μL Klenow enzyme (40 U/µL; Invitrogen) were mixed and incubated at 37°C for 2.0 h. The labeling reaction was stopped by adding 5 μL stop buffer (Invitrogen). For all experiments, reference samples were labeled with Cy3 and experimental samples with Cy5. Cy3 and Cy5 labeled probes were purified separately using an AutoSeqTM G-50 Dye Terminator Removal Kit (GE Healthcare) and labeling efficiency quantified using a NanoDrop® ND-1000 spectrophotometer.
Hybridization protocol
Purified Cy3 and Cy5 labeled products were then pooled, ethanol precipitated, resuspended in 45 µL hybridization buffer (40 % formamide, 5x Denhardt’s, 5x SSC, 1 mM sodium pyrophosphate, 50 mM Tris (pH 7.4) and 0.1 % SDS) and incubated at 95°C for 5 min followed by 50°C for 5 min. Arrays were pre-hybridized for 26 h at 42°C in hybridization buffer prior to hybridization with labeled probes. Labeled cDNA was hybridized overnight at 42°C.
Scan protocol
Microarray slides were scanned with a GenePix® 4000B scanner (Axon Instruments) with GenePix® Pro 6.0 (Axon Instruments) software using a modified protocol as described by Aragon and colleagues.
Description
day 4 post-exposure to S. mansoni (8) Each array was probed with total RNA converted to cDNA of one Cy3 labeled GFP knock-down snail and one Cy5 labeled FREP3 knock-down snail from the same time point. There are ten from each time point (2dpe and 4dpe) for each treatment type.
Data processing
A preloaded grid was used to align and identify array spots. Alignment diameter minimum and maximums were set at 50% and 200%, respectively. Nearest negative control spots were selected for background subtraction. Acuity version 4.0 (Axon Instruments) software was used in array analyses and arrays were normalized using a ratio of medians to Myosin essential light chain. SAM was used to determine significantly differentially regulated genes with a cut of 1-fold and a 5% false detection rate.
