 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 30, 2024 |
| Title |
MEK1_NGS_Day5_257 |
| Sample type |
SRA |
| |
|
| Source name |
kidney
|
| Organism |
Mesocricetus auratus |
| Characteristics |
tissue: kidney
cell line: BHK-21
cell type: fibroblast cells
genotype: repRNA-v4 based
treatment: molnupiravir
|
| Treatment protocol |
Medium was replaced with fresh medium containing 5 μg/mL puromycin 24 h post-electroporation (i.e., Day 1). After 4 days of selection by puromycin (i.e., on Day 5), approximately 2 million of cells were transferred to a new 10-cm dish and subjected to RNA mutagenesis using a concentration of 2 μM molnupiravir. On Day 7,therapeutic drug (2-5 μM cobimetinib) was added into the medium for selection. Puromycin and molnupiravir were also added to the medium simultaneously. One week later (i.e., Day 14), survived cells were collected for total RNA extraction, sequencing, and mutation analysis.
|
| Growth protocol |
BHK-21 cells were cultivated in Minimum Essential Medium with Earle's Balanced Salts (MEM/EBSS) supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/ml streptomycin, and 1% MEM Non-Essential Amino Acids Solution (Gibco, #11140050) in a humidified 37℃ incubator with 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The cells collected during the directed evolution experiments were harvested, and total RNA was extracted using TRIzol™ Reagent (Thermo Fisher Scientific, #15596018). Subsequently, approximately 3 μg of total RNA was reverse transcribed using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, #R312-02) with a primer (SINDBIS_GSPR2: TGCGCCTCCTCGGAAATACG) located in the 3′ untranslated region of the replicative RNA.
For Pacbio sequencing, The MEK1-T2A-PuroR barcode region was amplified from both the DNA library plasmid and the cDNA libraries using indexed primers. The purified PCR products were mixed and subjected to adapter ligation, fragment selection, primer and polymerase binding, followed by sequencing using a PacBio Sequel IIe instrument for Circular Consensus Sequencing (CCS) reads acquisition. For Fast NGS sequencing, Target gene (e.g., MEK1) were amplified from the cDNA samples via 28 rounds of PCR using KOD OneTM PCR Master Mix and primers specific to each target (For a 50 μl PCR reaction, 5 μl cDNA was used as template). The PCR product was purified using the HiPure Gel Pure DNA Micro Kit (Magen, #D2110-03). The gel-purified PCR product (approximately 1 μg) was subjected to sequencing. In brief, the experimental workflow involved the following steps: Firstly, DNA was enzymatically digested using Tn5 with sequence adaptors. Secondly, the digested products were subjected to PCR amplification using indexed sequencing primers. Finally, the resulting PCR products were recovered and subjected to sequencing using an Illumina MiSeq platform, ensuring a sequencing depth exceeding 500× on the target gene for accurate estimation of mutation frequency.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
The resulting Pacbio sequencing data were demultiplexed based on samples and barcodes using in-house Python scripts. The MEK1 region was aligned to MEK1 reference sequence using BWA 0.7.17-r1188. Mutation (mismatch) information for each sequencing read was obtained from the bam file using pysam 0.18.0 and custom Python scripts. Besides, to analyze the NGS data, Trimmomatic 0.39 was used to remove the 5' end 15-bp low quality sequence of the FASTQ file. BWA 0.7.17-r1188 was employed to map the resulting cleaned reads to the reference sequence. The resulting bam files were processed using a command mpileup from samtools to generate bcf file. To precisely profile the mutational frequency, nucleotides with sequencing quality score below Q30 were discarded. Then, custom Bash and Python scripts were used to extract the mutation information and calculate the mutation frequency. The mutation frequency at each specific position within the target gene is calculated by dividing the number of mutated bases (transversion and transition) at that position by the total number of bases sequenced at the specific position.
Assembly: Coding sequence of MEK1 from H. sapiens
Supplementary files format and content: The processed files in txt format contain information about the sequenced read number for each barcode and the mutation (mismatch) number for each read. While the processed files in xlsx format contain information such as the number of aligned bases per position, the number of base mutations per mutation type (i.e., A>T, A>G, A>C…), the count of base deletions and insertions, the total number of mapped bases, and the frequency of base mutations.
|
| |
|
| Submission date |
Jul 09, 2024 |
| Last update date |
Sep 30, 2024 |
| Contact name |
Yihan Lin |
| E-mail(s) |
yihan.lin@pku.edu.cn
|
| Organization name |
Peking University
|
| Street address |
No.5 Yiheyuan Road, Haidian
|
| City |
Beijing |
| ZIP/Postal code |
10087 |
| Country |
China |
| |
|
| Platform ID |
GPL29575 |
| Series (2) |
| GSE235343 |
Replicative RNA enables directed evolution and Darwinian adaptation in mammalian cells |
| GSE271875 |
Tracing the lineage of replicative RNAs carrying MEK1 in the evolution of drug resistance |
|
| Relations |
| BioSample |
SAMN42389425 |
| SRA |
SRX25260173 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8387392_MEK1_NGS_Day5_257_nt_mutation.xlsx |
110.2 Kb |
(ftp)(http) |
XLSX |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
