 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 31, 2024 |
| Title |
37_NRDE3_enri2_late_Input1 |
| Sample type |
SRA |
| |
|
| Source name |
embryo
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
cell type: embryo
antibody: FLAG (Sigma Aldrich, A2220)
strain: USC1593 - enri-2(cmp330) nrde-3(tor131[GFP::3xFLAG::nrde-3]) X
Stage: late embryos (>=300cell)
experimental temperature: 17C
fraction: input
|
| Growth protocol |
Sychronized early adult animals were grown on enriched peptone plates seeded with OP50 E. coli at 17°C. Adult C. elegans stage was monitored carefully under DeltaVision microscope by live imaging. For early embryo collection (<=100-cell), adult animals were washed off from plates with H2O and bleached as soon as the first animals had 1-4 eggs (around 68-70 hours depending on the strain and the incubator temperature). For late embryo collection (>=300-cell), adult animals were washed off from plates with H2O and bleached when about half of the worms had 1~6 eggs (~70-72 hours depending on the strain and the incubator temperature). After bleaching, embryos were washed twice with M9 buffer, and filtered through 40µm cell strainers (Fisherbrand™ Sterile Cell Strainers, 40µm) twice to clear the residual worm body. To reach >=300-cell stage for late embryo collection, embryos were additionally incubated in M9 buffer at 20°C for 4.5 hours.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For immunoprecipitation followed by small RNA sequencing in embryos, ∼500,000 synchronized embryos were sonicated with Fisher Sonifier 550 with a microtip (15s on, 45s off, 10% power, total 2 minutes on time). After sonication, insoluble particulate was removed by centrifugation at 21,000g for 30 minutes. Immunoprecipitation was performed using anti-FLAG Affinity Matrix (Sigma Aldrich, A2220). NRDE-3-bound RNAs were isolated using TRIzol reagent (Thermo Fisher, 15596018), followed by chloroform extraction and isopropanol precipitation.
Small RNAs (18 to 30-nt) were size selected on homemade 10% Urea-polyacrylamide gels from total RNA samples. Small RNAs were treated with 5’ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3’ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer, ligated to the 5’ adapter with T4 RNA ligase (NEB M0204L), and reverse transcribed with Superscript III (Thermo Fisher 18080-051). Small RNA libraries were amplified using Q5 High-Fidelity DNA polymerase (NEB M0491L) and size selected on a homemade 10% polyacrylamide gel. Library concentration was determined using the Qubit 1X dsDNA HS Assay kit (Thermo Fisher Q33231) and quality was assessed using the Agilent BioAnalyzer. Libraries were sequenced on the Illumina NextSeq2000 (SE 75-bp reads) platform.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
size-selected small RNA
|
| Data processing |
Small RNA libraries were sequenced on the Illumina NextSeq2000 (SE 75-bp reads) platform.
Sequences were parsed from adapters using FASTQ/A Clipper (options: -Q33 -l 17 -c -n -a TGGAATTCTCGGGTGCCAAGG) and quality filtered using the FASTQ Quality Filter (options: -Q33 -q 27 -p 65) from the FASTX-Toolkit
Contamination from reads mapping to 18-mer and 28-mer size standards were filtered out using Cutadapt (version 3.4)
Filtered reads were mapped to the C. elegans genome WS258 using Bowtie2 v. 2.5.0 (default parameters)
Reads were assigned to genomic features using featureCounts (options: -t exon -g gene_id -O --fraction –largestOverlap) which is part of the Subread v. 2.0.1 package.
Assembly: WS258
Supplementary files format and content: Processed data files are tab-delimited text files including total reads mapping to each gene generated by FeatureCounts.
|
| |
|
| Submission date |
Jul 26, 2024 |
| Last update date |
Jul 31, 2024 |
| Contact name |
Carolyn Marie Phillips |
| E-mail(s) |
cphil@usc.edu
|
| Organization name |
University of Southern California
|
| Department |
Biological Sciences
|
| Lab |
Phillips
|
| Street address |
1050 Childs Way, RRI 201
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90089 |
| Country |
USA |
| |
|
| Platform ID |
GPL32326 |
| Series (1) |
| GSE273239 |
Nuclear Argonaute protein NRDE-3 switches small RNA binding partners during embryogenesis coincident with the formation of SIMR granules |
|
| Relations |
| BioSample |
SAMN42841795 |
| SRA |
SRX25488406 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8424734_37_NRDE3_enri2_late_Input1_3.txt.gz |
1.6 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
