GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM861617

Query DataSets for GSM861617

Status

Public on Mar 31, 2013

Title

chromosomal forum domains termini 1

Sample type

SRA

Source name

HEK293T cells

Organism

Homo sapiens

Characteristics

cell line: HEK293T cells
passages: regular cultured cells

Treatment protocol

HEK 293 cells were seeded in 10 cm culture plates 1-2 days before experiment in DMEM containing 10% FBS, and used at approximately 60-80% confluency.

Growth protocol

The cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemente+B29d with 10% FBS penicillin (100 U/ml), streptomycin (100ug/ml) and L-glutamine (4 mM).

Extracted molecule

genomic DNA

Extraction protocol

Forum domains preparation:
DNA-agarose plugs were prepared as described before [Tchurikov NA and Ponomarenko NA (1992) Detection of DNA domains in Drosophila, human and plant chromosomes possessing mainly 50- to 150-kilobase stretches of DNA. Proc Natl Acad Sci USA 89: 6751-6755]. About 6 millions of HEK293T cells in 2 ml of culture medium were pelleted by centrifugation at 2000 rpm, resuspended in 0.3 ml of the same medium, gently mixed at 42°C with an equal volume of a 1% agarose L (LKB) in PBS solution, and distributed on a mold containing 100-microliters wells. The mold was placed on ice for 2-5 min, covered with parafilm. The agarose plugs were then placed in Petri dishes with 5 ml of solution containing 0.5 M EDTA (pH 9.5), 1% sodium laurylsarcosine, and 1-2 mg of proteinase K solution per ml for 40-48 hr at 50°C, and stored at 4°C in the same solution. Each DNA-agarose plus usually contained about 15 microgramms of DNA corresponding to about 1 millions of cells.
To test the quality of isolated DNA the fractionation in the pulsed-field gels was performed as described before (Tchurikov and Ponomarenko, 1992). Portions of the original agarose-DNA plugs (5-50 microliters) containing 1-10 microgramms of DNA were used for electrophoresis without any restriction enzyme digestion. The DNA samples were run in 0.8% agarose gels on an LKB Pulsaphor system using hexagonal electrode and switching times of 25 or 450 sec.
For elution of DNA preparations the fractionation in 1% agarose conventional mini-gel was performed. One-half of DNA-agarose plug was washed in 1xTE 3 times (for 15 min each) following by 3 times washing in the same solution containing 17.4 microgramms/ml PMSF in ethanol. After fractionation in the mini-gel, the ethidium-bromide stained DNA band was excised and electoeluted inside the dialysis cellulose membrane bag. After overnight dialysis without stirring against 1 liter of 0.01 x TE at 4°C, the DNA was concentrated with PEG (4°C) and redialyzed.
.
Rapid amplification of forum domains termini (RAFT) procedure:
About 1.5 microgramms of isolated DNA (see above) was treated with Klenow fragment and then ligated with 70 ng of double-stranded oligonucleotide (25 bp long 5’-phosphorylated 5’ pCCCCTGCAGTATAAGGAGAATTCGGG 3’ oligonucleotide annealed with 26 bp long 5’ biotinylated 5’ bio-CCGAATTCTCCTTATACTGCAGGGG 3’ oligonucleotide) in 150 microliters of solution containing 0.1 M NaCl, 50 mM Tris HCl (pH 7.4), 8 mM MgCl2, 9 mM 2-mercaptoethanol, 7 microM ATP, 7.5 % PEG, and 40 units of T4 DNA ligase at 20°C for 16 hr. After heating at 65°C for 10 min the DNA preparation was digested with Sau3A enzyme to shorten the forum domain to the termini attached to the ligated oligonicleotide. The selection of such termini was performed in 0.5 ml eppendorf tubes using 300 microliters of suspension containing streptavidin magnespere paramagnetic particles, SA-PMP (Promega) according to the manufacturer's recommendations. After extensive washing with 0.5xSSC removing DNA fragments corresponding to internal parts of forum domains, the forum termini (FT) DNA preparation was eluted from the SA-PMP using digestion with EcoRI enzyme in final volume of 50?mictolitres (double-stranded FT). The FT were then ligated with 100x molar excess of double-stranded Sau3A adaptor (5’-phosphorylated 5’ pGATCGTTTGCGGCCGCTTAAGCTTGGG 3’ oligonucleotide annealed with 5’ CCCAAGCTTAAGCGGCCGCAAAC 3’ oligonucleotide). In some experiments (FT) DNA preparation was eluted from the SA-PMP using heating by incubation at 100°C for 3 min in 50 microliters of 0.01xTE (single-stranded FT). Before heating the FT preparation was ligated with100x molar excess of double-stranded Sau3A adaptor in suspension with SA-PMP (see above). Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5’ CCCAAGCTTAAGCGGCCGCAAAC 3’); 1 microg of primer corresponding to biotinilated oligonucleotide (5’ CCGAATTCTCCTTATACTGCAGGGG 3’) and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

454 GS FLX

Description

contains data from chromosomes
Amplicon

Data processing

The processing of the raw sff data was the following: conversion from sff to fasta format was performed by PyroBayes software package (http://bioinformatics.bc.edu/marthlab/PyroBayes), then two primers was cut-off by means of the pair alignment made by FASTA version 34.26.5 (http://faculty.virginia.edu/wrpearson/fasta) with the following parameters "-z 11,12,14,15 -A -E 0.01 -n -m 9 -Q". Then all sequences shorter than 18bp has been removed from the filtered dataset. The final mapping was performed by the bwatools (http://bio-bwa.sourceforge.net) and samtools (http://samtools.sourceforge.net) with the Homo sapiens masked genome (assembly GRCh37/hg19) as the database. Original 357893 reads from two .SFF files were mapped in repeat-masked Human genome (assembly GRCh37p5/hg19, February, 2009), and then aligned into 75794 “clusters”, possessing up to 456 reads each. FT is defined as a cluster containing at least two reads overlapping non less than 0.8 of their length (1+0.8=1.8 threshold; p<0.00019). The sequences corresponding to 75794 mapped clusters are presented in table.txt (linked as supplementary file to Series record). Finally 16535 FT containing at least 2 distinct reads, 0.8 overlapping, were selected. The selected FT produce in sequenced chromosomes the pattern of DNA fragments corresponding to one observed in the pulsed-field gels.These reads are presented in deposited .gff and .wig files split by chromosomes for the convenience. The data that are inside .gff and .wig files are the same, only format differs.

Submission date

Jan 12, 2012

Last update date

May 15, 2019

Contact name

Nickolai Tchurikov

E-mail(s)

tchurikov@eimb.ru

Organization name

Engelhardt Institute of Molecular Biology

Department

Department of Epigenetic Mechanisms of Gene Expression Regulation