|
| Status |
Public on Jun 25, 2012 |
| Title |
Hrde sensor nrde-2 F1 (B) |
| Sample type |
SRA |
| |
|
| Source name |
whole animal
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
genotype: Hrde sensor in nrde-2
developmental stage: adult
barcode: NA
library construction: Protocol 2
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Libraries were constructed using one of two protocols as indicated in sample information. Protocol 1: Total RNA was isolated using the mirVana miRNA isolation kit (Ambion). The total RNA samples were separated on denaturing 15% polyacrylamide gels and 18-30 nt length species selected. Following poly-A tailing, small RNAs were treated with tobacco acid pyrophosphatase (Epicentre). Adapters were then ligated to the 5’ phosphate of the RNA. First-strand cDNA synthesis was performed using an oligo(dT)-adapter primer and the M-MLV reverse transcriptase. The resulting cDNAs were PCR-amplified to about 20-30 ng/μl in 18-20 PCR cycles using a high fidelity DNA polymerase. cDNA were purified using the Macherey & Nagel NucleoSpin Exctract II kit. Libraries were sequenced on the Illumina GA IIx platform. Protocol 2: Total RNA was isolated using TRIsure reagent (Bioline). Total RNA was treated with RNA 5’ polyphosphatase (Epicentre). cDNA libraries were then prepared following the TruSeq Small RNA protocol (Illumina). Libraries were size selected on Novex® 6% TBE gels (Invitrogen) and sequenced on the Illumina MiSeq platform.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
Hrde sensor nrde-2, F1 after treatment with dsRNA targeting GFP (B)
|
| Data processing |
Fastq sequence reads with missing bases were excluded. Protocol 1: Reads were trimmed by removing the first four bases corresponding to 5' barcodes and any 3' As. Protocol 2: Reads were trimmed by removing 3' adapter sequences (TGGAATTCTCGGGTGCCAAGG) requiring a minimum of 6 overlapping bases and at most 2 mismatches. Inserts with length 18-30 nucleotides were collapsed to unique sequences, retaining the number of reads for each sequence. The C. elegans genome (assembly WS190/ce6) was downloaded from the UCSC Genome Browser website (http://genome.ucsc.edu/) (Kent et al. 2002, Fujita et al. 2010). Perfect matches to the reference genome and transgene constructs (if applicable) were identified using bowtie in -v alignment mode, allowing for multiple matches (Langmead et al. 2009).
Genome_build: WS190/ce6
Supplementary_files_format_and_content: BED files including perfect alignments to the reference genome and transgene sequences (if applicable). Entries in the 'name' column have format sequence-#reads/#alignments. The 'score' column indicates the number of mismatches.
|
| |
|
| Submission date |
Jun 19, 2012 |
| Last update date |
Feb 15, 2024 |
| Contact name |
Leonard Goldstein |
| Organization name |
Garvan Institute of Medical Research
|
| Street address |
384 Victoria St
|
| City |
Darlinghurst |
| ZIP/Postal code |
2010 |
| Country |
Australia |
| |
|
| Platform ID |
GPL15716 |
| Series (1) |
| GSE38813 |
piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans |
|
| Relations |
| SRA |
SRX155132 |
| BioSample |
SAMN01055331 |
