|
| Status |
Public on Nov 01, 2012 |
| Title |
RDR6-1 |
| Sample type |
SRA |
| |
|
| Source name |
Root
|
| Organism |
Medicago truncatula |
| Characteristics |
primer index (truseq small rna sample kit): Primer index 1
organ: root
developmental stage: 10 day old plants
genotype: rdr6.1-A
|
| Growth protocol |
roots of 10 day old plants
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Small RNA enrichement with the MIRVANA kit (Ambion) - small RNA library construction using the TruSeq small RNA sample preparation kit (Illumina)
small RNA fractions were purified from total RNA using the miRVANA kit (Ambion) and small RNA libraries were constructed following the protocol of the TruSeq small RNA sample preparation kit (Illumina)using Primer Index 1 or Primer index 3.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
small RNA fraction
|
| Data processing |
Sequenced reads were trimmed for adaptor sequence (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC), rRNA sequences was removed using blastn program (maxmismatch number=2), only sequences of length 18-25nt was kept.
Supplementary_files_format_and_content: tab-delimited text files. First column 'SEQUENCE' = nucleotidic sequence, second column 'COUNT'= number of times sequenced
|
| |
|
| Submission date |
Jul 17, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Erika Sallet |
| E-mail(s) |
Erika.Sallet@toulouse.inra.fr
|
| Organization name |
INRA/CNRS
|
| Department |
Plant Health and the Environment
|
| Lab |
LIPM
|
| Street address |
24 Chemin de Borde Rouge, CS 52627
|
| City |
Castanet Tolosan |
| ZIP/Postal code |
31326 |
| Country |
France |
| |
|
| Platform ID |
GPL15815 |
| Series (1) |
| GSE39421 |
small RNA sequencing of the M.truncatula rdr6.1 mutant |
|
| Relations |
| SRA |
SRX160456 |
| BioSample |
SAMN01090671 |
