NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL11350 Query DataSets for GPL11350
Status Public on Jun 01, 2011
Title Illumina Custom Prostate Cancer DASL Panel miRNA
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol Sentrix® Array Matrix The sophisticated Sentrix Array Matrix (SAM) platform is a fiber-optic assembly composed of 96 individual arrays arranged in an 8-by-12 format, matching the well spacing of a standard microwell plate. Each individual array in the matrix holds 1,536 different oligonucleotide probe sequences (IllumiCode sequences), in turn attached to 3-micron beads assembled into microwells at the end of the optical fiber bundle. Because the microwells outnumber probe sequences, multiple copies of each bead type are present in the array. This built-in redundancy further improves robustness and measurement precision. The SAM manufacturing process includes hybridization-based quality control for each array feature, allowing consistent production of high-quality, reproducible arrays. See manufacturer's website for more details.
 
 
Submission date Dec 21, 2010
Last update date Jun 01, 2011
Contact name Gregory Doho
E-mail(s) gdoho@emory.edu
Organization name Emory University
Street address 1365B Clifton Rd NE
City Atlanta
State/province GA
ZIP/Postal code 30322
Country USA
 
Samples (214) GSM644235, GSM644236, GSM644237, GSM644238, GSM644239, GSM644240 
Series (4)
GSE26245 [miRNA Training Set] Protein-coding and MicroRNA Biomarkers of Recurrence of Prostate Cancer Following Radical Prostatectomy
GSE26247 [miRNA Validation Set] Protein-coding and MicroRNA Biomarkers of Recurrence of Prostate Cancer Following Radical Prostatectomy
GSE26367 Protein-coding and MicroRNA Biomarkers of Recurrence of Prostate Cancer Following Radical Prostatectomy

Data table header descriptions
ID
SEARCH_KEY Internal id useful for custom design array
PROBE_ID Illumina ID
CHROMOSOME Chromosome number
TargetID Target miRNA
SEQUENCE Probe sequence
SPECIES Species
miRNA_ID
miRNA_ID
SPOT_ID spot identifier

Data table
ID SEARCH_KEY PROBE_ID CHROMOSOME TargetID SEQUENCE SPECIES miRNA_ID miRNA_ID SPOT_ID
ILMN_3167304 HS_1 ILMN_3167304 0 HS_1 GATGCTGGGGAGCCATG human HS_1
ILMN_3168038 HS_10 ILMN_3168038 0 HS_10 ACTGGAGATATGGAAGAGCT human HS_10
ILMN_3167890 HS_100 ILMN_3167890 0 HS_100 ATCCCACCGCTGCCAAAA human HS_100
ILMN_3167526 HS_101 ILMN_3167526 0 HS_101 TCCTGTCTGTTCTCCCC human HS_101
ILMN_3167209 HS_104 ILMN_3167209 0 HS_104 ACCCCTTCGGCTGCTGGG human HS_104
ILMN_3168219 HS_105 ILMN_3168219 0 HS_105 CTGGGCGGGTGGTAGGT human HS_105
ILMN_3167464 HS_106 ILMN_3167464 0 HS_106 AGCTGGTGTTTGTGAATC human HS_106
ILMN_3167213 HS_107 ILMN_3167213 0 HS_107 CCACTGATCTCGGTCGA human HS_107
ILMN_3167057 HS_108.1 ILMN_3167057 0 HS_108.1 TGAGGTAGTAGGTGGTGTG human HS_108.1
ILMN_3168313 HS_109 ILMN_3168313 0 HS_109 TCTCCAGCTGGGACCCT human HS_109
ILMN_3166972 HS_11.1 ILMN_3166972 0 HS_11.1 TACACTGACGGAGCCAG human HS_11.1
ILMN_3168149 HS_110 ILMN_3168149 0 HS_110 CTCTGTGCTGTGCGTAGT human HS_110
ILMN_3168527 HS_111 ILMN_3168527 0 HS_111 AGGGTGGAGGTTGGCGGG human HS_111
ILMN_3167562 HS_112 ILMN_3167562 0 HS_112 AGTCCTCCGGCCCTTCCTCCC human HS_112
ILMN_3168099 HS_113 ILMN_3168099 0 HS_113 TAGCCCCCAGGCTTCAC human HS_113
ILMN_3168017 HS_114 ILMN_3168017 0 HS_114 GGCGAGGAGGCCCTTTA human HS_114
ILMN_3167545 HS_115 ILMN_3167545 0 HS_115 AATGTGGAAGTGGTCTGA human HS_115
ILMN_3167951 HS_116 ILMN_3167951 0 HS_116 TCTGGGCTGCGGGCCTGGGAA human HS_116
ILMN_3167172 HS_117 ILMN_3167172 0 HS_117 CCGCACCAAGAGGCCGCC human HS_117
ILMN_3167994 HS_119 ILMN_3167994 0 HS_119 GGGAGGACAAAGGACTG human HS_119

Total number of rows: 1145

Table truncated, full table size 111 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap