 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 30, 2011 |
| Title |
Lactobacillus plantarum WCFS1 15K 60-mer array, Version 3.1, our ID LPAG3.1_8 |
| Technology type |
in situ oligonucleotide |
| Distribution |
custom-commercial |
| Organism |
Lactiplantibacillus plantarum |
| Manufacturer |
Agilent Technologies |
| Manufacture protocol |
see manufacturer's web site at http://www.agilent.com/
|
| |
|
| |
|
| Submission date |
Jul 27, 2011 |
| Last update date |
Jul 27, 2011 |
| Contact name |
Michiel Wels |
| E-mail(s) |
michiel.wels@nizo.com
|
| Organization name |
NIZO food research
|
| Street address |
Kernhemseweg 2
|
| City |
Ede |
| ZIP/Postal code |
6718 ZB |
| Country |
Netherlands |
| |
|
| Samples (117)
|
GSM768146, GSM768147, GSM768148, GSM768149, GSM768150, GSM768151
GSM768152, GSM768153, GSM768154, GSM768155, GSM768156, GSM769590, GSM769591, GSM769592, GSM769593, GSM769594, GSM769595, GSM769596, GSM769597, GSM769598, GSM769599, GSM769600, GSM769601, GSM769602, GSM769603, GSM769604, GSM769605, GSM769606, GSM769607, GSM769608, GSM769609, GSM769610, GSM769611, GSM769612, GSM769613, GSM769614, GSM769615, GSM769616, GSM769617, GSM769618, GSM769619, GSM769620, GSM769621, GSM769622, GSM769623, GSM769624, GSM769625, GSM769626, GSM769627, GSM769628, GSM769629, GSM769630, GSM769631, GSM769632, GSM769633, GSM769634, GSM769635, GSM769636, GSM769637, GSM769638, GSM769639, GSM769640, GSM769641, GSM769642, GSM769643, GSM769644, GSM769645, GSM774667, GSM774668, GSM774669, GSM774670, GSM774671, GSM774672, GSM774673, GSM774674, GSM774675, GSM774676, GSM774677, GSM774678, GSM774679, GSM774680, GSM774681, GSM774682, GSM774683, GSM774684, GSM774685, GSM774686, GSM774687, GSM774688, GSM774689, GSM774690, GSM774691, GSM774692, GSM774693, GSM774694, GSM853452, GSM853453, GSM853454, GSM853455, GSM853456, GSM853457, GSM853458, GSM853459, GSM853460, GSM853461, GSM860051, GSM860052, GSM860053, GSM860054, GSM860055, GSM860056, GSM860057, GSM860058, GSM874439, GSM874440, GSM874441, GSM874442
|
| Series (7)
|
| GSE31000 |
L. plantarum growth curve experiment sampled a different optical densities |
| GSE31076 |
L. plantarum grown in a variety of different fermentation conditions |
| GSE31253 |
The CtsR and HrcA regulon of Lactobacillus plantarum WCFS1 at normal and elevated temperature Nov 01, 2011 approved |
| GSE31254 |
Modulation of Lactobacillus plantarum gastrointestinal robustness by fermentation conditions enables identification of bacterial robustness markers |
| GSE34690 |
Characterization of the the L. plantarum capsular polysaccharide clusters |
| GSE34999 |
The impact of Lactobacillus plantarum sortase on target-protein sorting, gastrointestinal persistence and host immunomodulation |
| GSE35754 |
Comparative analysis of bacterial transcriptome using DNA microarray and next generation sequencing technologies |
|
| Data table header descriptions |
| ID |
|
| OLIGO_ID |
Internal ID of the clone |
| SEQUENCE |
sequence of the oligonucleotide |
| ORF |
|
| SPOT_ID |
internal ID of the spot, if not based on a L. plantarum gene |
| Data table |
| ID |
OLIGO_ID |
SEQUENCE |
ORF |
SPOT_ID |
| 1 |
(+)E1A_r60_1 |
|
|
--(+)E1A_r60_1 |
| 2 |
(+)E1A_r60_3 |
|
|
--(+)E1A_r60_3 |
| 3 |
(+)E1A_r60_a104 |
|
|
--(+)E1A_r60_a104 |
| 4 |
(+)E1A_r60_a107 |
|
|
--(+)E1A_r60_a107 |
| 5 |
(+)E1A_r60_a135 |
|
|
--(+)E1A_r60_a135 |
| 6 |
(+)E1A_r60_a20 |
|
|
--(+)E1A_r60_a20 |
| 7 |
(+)E1A_r60_a22 |
|
|
--(+)E1A_r60_a22 |
| 8 |
(+)E1A_r60_a97 |
|
|
--(+)E1A_r60_a97 |
| 9 |
(+)E1A_r60_n11 |
|
|
--(+)E1A_r60_n11 |
| 10 |
(+)E1A_r60_n9 |
|
|
--(+)E1A_r60_n9 |
| 11 |
(+)eQC-39 |
|
|
--(+)eQC-39 |
| 12 |
(+)eQC-40 |
|
|
--(+)eQC-40 |
| 13 |
(+)eQC-41 |
|
|
--(+)eQC-41 |
| 14 |
(+)eQC-42 |
|
|
--(+)eQC-42 |
| 15 |
(-)3xSLv1 |
|
|
--(-)3xSLv1 |
| 16 |
AG1SRP#1 |
GTGTCAGGTCCGGAAGGAAGCAGCACTAAGTTTGCTTCATCTTGTGCCTTTTGTTTTTAT |
|
--AG1SRP#1 |
| 17 |
AG1antilp_1220 |
ATGCTAGGCTCCCCCACACAATTGCTAGCCGTTTTCTCATCTTCAATCATCACACATTCT |
|
--AG1antilp_1220 |
| 18 |
AG1antilp_3468 |
ATGACTTGCCAAGGCTTAAACTTACCCCAACGTGTTTCCGTATTATCAACAATATTGCCT |
|
--AG1antilp_3468 |
| 19 |
AG1antilp_3469 |
ATGATAACTTTTTCTTGGTTACTGGTTGTTGTTCAACATTTTGTGCCATTAATTTCACCC |
|
--AG1antilp_3469 |
| 20 |
AG1lp_0001#1 |
GATCTCGAGACGCGGATTGCTATTTTGCGCAATAAAGCCGATCTTGAAGGGATCGAAATC |
lp_0001 |
|
Total number of rows: 9271
Table truncated, full table size 793 Kbytes.
| Supplementary data files not provided |
|
|
|
|
 |
Less...
More...