NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL16243 Query DataSets for GPL16243
Status Public on Jun 01, 2013
Title Agilent-020166 Ca21_GE_plus_tiling_2.0 (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Candida albicans
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description This is an expression array built off of the C. albicans genome assembly 21 orf list, with the alpha locus and additional tiling probes spanning the WOR1, WOR2, WOR3, CZF1 and EFG1 loci. This is the same as AMADID 020128 with the exception of the additional tiling probes for mapping transcription start sites.

Arrays of this design have barcodes that begin with 16020166 or 2520166.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL16260.
 
Submission date Nov 05, 2012
Last update date Jun 01, 2013
Contact name Aaron Hernday
Organization name UC San Francisco
Street address 600 15th st
City San Francisco
State/province Ca
ZIP/Postal code 94156
Country USA
 
Samples (52) GSM1328050, GSM1328051, GSM1328052, GSM1328053, GSM1328054, GSM1328055 
Series (4)
GSE55026 Co-culture of C. albicans with bacteria
GSE90819 Candida albicans: Control vs. sulfite-treated cells
GSE160782 Gene Expression Arrays comparing C. albicans SN250 during planktonic and biofilm growth in different media
Relations
Alternative to GPL16260 (Probe Name version)

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
GENE_SYMBOL Gene Symbol
ACCESSION_STRING Accession String
ORF Candida Genome Database ID
CHROMOSOMAL_LOCATION Chromosomal Location
Chromosome
RANGE_START
RANGE_END
SEQUENCE Sequence
DESCRIPTION Description

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE GENE_SYMBOL ACCESSION_STRING ORF CHROMOSOMAL_LOCATION Chromosome RANGE_START RANGE_END SEQUENCE DESCRIPTION
1 96 164 GE_BrightCorner GE_BrightCorner pos
2 96 162 DarkCorner DarkCorner pos
3 96 160 DarkCorner DarkCorner pos
4 96 158 Ca21_GE_05227 Ca21_GE_05227 FALSE orf19.213|CGDID|CAL0003893 CAL0003893 chr2:1818265-1819098 chr2 1818265 1819098 TTGCCCAAAGAATTTTGGAAATTGGAGCATTATCGTCATTATTAACCAACAACTATTCCG Predicted ORF in Assemblies 19, 20 and 21
5 96 156 Ca21_GE_05641 Ca21_GE_05641 FALSE TLO7 orf19.5467|CGDID|CAL0005302 CAL0005302 chr3:0013756-0014265 chr3 13756 14265 CAGAGTGGTGTCTCGGCGTTATGGTTGAAAAGAAAAAGAAACTTGACGAATTGAAAGTCA Member of a family of telomere-proximal genes of unknown function; may be spliced in vivo
6 96 154 Ca21_GE_03607 Ca21_GE_03607 FALSE orf19.1466|CGDID|CAL0004656 CAL0004656 chr2:0283164-0283877 chr2 283164 283877 CTCACACTGCAAAATCGGATATCTTGGAGAGTATTGAACAACTAAAATGGTATAGAAAGT Predicted ORF in Assemblies 19, 20 and 21
7 96 152 Ca21_GE_06730 Ca21_GE_06730 FALSE orf19.5954|CGDID|CAL0003375 CAL0003375 chr3:1043699-1045319 chr3 1043699 1045319 GGTAGCGACATAATTGAACTCTTGGAAGGAATATCTAAAACCGGTGACGTGATTAGATAA Predicted ORF in Assemblies 19, 20 and 21
8 96 150 Ca21_GE_06970 Ca21_GE_06970 FALSE orf19.7372|CGDID|CAL0004753 CAL0004753 chr3:1329388-1332714 chr3 1329388 1332714 GGATTTGGTGGACAAAGTAAAAGTTCTAACAATGGAGAAGCTGATCTTAGTTCATTTGAT Predicted zinc-finger protein of unknown function
9 96 148 Ca21_GE_08029 Ca21_GE_08029 FALSE orf19.2736|CGDID|CAL0004217 CAL0004217 chr4:0547578-0547138 chr4 547578 547138 GCAATTGAAAACACTGAACAATTTGATTTCTTAGTGGAAGCGGTTGAAAAGTATCCATCT Predicted ORF in Assemblies 19, 20 and 21; flucytosine induced
10 96 146 NA NA ignore
11 96 144 Ca21_GE_09554 Ca21_GE_09554 FALSE HSP12 orf19.3160|CGDID|CAL0002358 CAL0002358 chr5:0466882-0466376 chr5 466882 466376 AAGCAAAGACCCTTGCTGAAACAGCTCAAGAATATGTCGAGGTTGCCAAAACTGAAATTG Heat-shock protein; induced upon osmotic-oxidative-cadmium stress, fluphenazine treatment, low iron, CDR1 and CDR2 overexpression, or ssn6 or ssk1 homozygous null mutation; repressed by Hog1p or flucytosine; similar to S. cerevisiae Hsp12p
12 96 142 Ca21_GE_03136 Ca21_GE_03136 FALSE orf19.7209|CGDID|CAL0003744 CAL0003744 chr1:3089373-3089780 chr1 3089373 3089780 GCAAGAGGGATTTACTCTTGTAATTCGACATATTACGCGGGCGATGAGGAATTGTTTTCT Predicted ORF in Assemblies 19, 20 and 21; induced by nitric oxide in yhb1 mutant
13 96 140 Ca21_GE_01055 Ca21_GE_01055 FALSE ERG3 orf19.767|CGDID|CAL0001905 CAL0001905 chr1:0992868-0991708 chr1 992868 991708 CACTTGTATTTCAACTACAATTACGGTCAATTCACTACTCTTTGGGATAGACTTGGTAAC C-5 sterol desaturase; introduces C-5(6) double bond into episterol in ergosterol biosynthesis; clinically-isolated homozygous null mutants show azole resistance, defects in hyphal growth and virulence; Efg1p-repressed; fluconazole-induced
14 96 138 Ca21_GE_05027 Ca21_GE_05027 FALSE IFM3 orf19.2176|CGDID|CAL0005418 CAL0005418 chr2:1641779-1640970 chr2 1641779 1640970 GGAAAGTGAAAACCATTGTTCCAGAACAATACAACTTGGAAATTAAACAAGGTCCATTAG Predicted ORF in Assemblies 19, 20 and 21; Plc1p-regulated
15 96 136 Ca21_GE_04138 Ca21_GE_04138 FALSE orf19.819|CGDID|CAL0002651 CAL0002651 chr2:0841136-0840804 chr2 841136 840804 CTTTAGATACTGTTGAAGCTTTAGTGGCATTGGAAGAAGAATTCGATTTAGAAATTCCTG Predicted ORF in Assemblies 19, 20 and 21
16 96 134 Ca21_GE_04001 Ca21_GE_04001 FALSE HSP78 orf19.882|CGDID|CAL0002893 CAL0002893 chr2:0709604-0707238 chr2 709604 707238 GTTCCAAACCACAGTGAAGGGACGGTTATTGAAAAGGAAGAAGACTATTTTAAAGAAGAT Protein described as a heat-shock protein; transcriptionally regulated by macrophage response; transcription is regulated by Nrg1p, Mig1p, Gcn2p, Gcn4p; heavy metal (cadmium) stress-induced
17 96 132 Ca21_GE_12129 Ca21_GE_12129 FALSE orf19.1341|CGDID|CAL0003821 CAL0003821 chr7:0738814-0737858 chr7 738814 737858 CTGAAACATACTCATCAATACAGTATGATGGAAAATCAAGTGATGTATGGTCTTTGGGTA Predicted ORF in Assemblies 19, 20 and 21
18 96 130 Ca21_GE_00181 Ca21_GE_00181 FALSE orf19.6020|CGDID|CAL0005067 CAL0005067 chr1:0168540-0169541 chr1 168540 169541 CCGGTTGCTCATAATACAACTTCAGTATCAATACATCCTTGTAAACATTCTTCAGTTATG Predicted ORF in Assemblies 19, 20 and 21
19 96 128 Ca21_GE_09213 Ca21_GE_09213 FALSE orf19.929|CGDID|CAL0003636 CAL0003636 chr5:0138904-0137597 chr5 138904 137597 TAACTGAATTCCCTAAATTAGAGTATGTTGTCAGAAATGGTGGGGTCAAGCTAGTAGATA Predicted ORF in Assemblies 19, 20 and 21
20 96 126 Ca21_GE_00859 Ca21_GE_00859 FALSE orf19.4459|CGDID|CAL0001881 CAL0001881 chr1:0815643-0813952 chr1 815643 813952 GGGATTGATCCAGTATTAAAATTGACTCGTTATGAACTGAATGGCAGTTTTACAACTTCA Predicted ORF in Assemblies 19, 20 and 21; similar to S. cerevisiae Ynl234wp, which is a putative heme-binding stress-related protein; transposon mutation affects filamentous growth

Total number of rows: 15744

Table truncated, full table size 4109 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap