NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL17276 Query DataSets for GPL17276
Status Public on Jun 26, 2014
Title Agilent-040871 Drosophila melanogaster 8X60K with Spike (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Drosophila melanogaster
Manufacturer Agilent Technologies
Manufacture protocol See manufacturer's web site at http://www.agilent.com/.
 
Description Arrays of this design have barcodes that begin with 16040871 or 2540871.
Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.
The ID column represents the Agilent Feature Extraction feature number.
Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).
To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.
 
Citation(s) 24746817
Submission date Jun 11, 2013
Last update date Jun 26, 2014
Contact name Masayuki Miura
E-mail(s) miura@mol.f.u-tokyo.ac.jp
Organization name the University of Tokyo, Grad. Sch. Pharm. Sci
Department Genetics
Street address 7-3-1, Hongo
City Bunkyo-ku
State/province Tokyo
ZIP/Postal code 1130033
Country Japan
 
Samples (15) GSM4042073, GSM4042074, GSM4042075, GSM4042076, GSM4042077, GSM4042078 
Series (1)
GSE136170 Gene expression profiling of wing imaginal disc upon caspase activity inhibition
Relations
Alternative to GPL17277

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq accession
GB_ACC GenBank or RefSeq accession
ORF ORF identifier
LOCUSLINK_ID LocusLink ID
UNIGENE_ID UniGene ID
CLONE_ID Clone ID
FLYBASE_ID FlyBase ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
ACCESSION_STRING Accession string
CHROMOSOMAL_LOCATION Chromosomal location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID Go IDs
SEQUENCE Sequence

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC ORF LOCUSLINK_ID UNIGENE_ID CLONE_ID FLYBASE_ID GENE_SYMBOL GENE_NAME ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 192 328 GE_BrightCorner GE_BrightCorner pos
2 192 326 DarkCorner DarkCorner pos
3 192 324 DarkCorner DarkCorner pos
4 192 322 A_09_P192255 A_09_P192255 FALSE tc|TC245297 chr2R:1199253-1199193 dm|2R41E4 Rep: Chromosome undetermined scaffold_110, whole genome shotgun sequence - Paramecium tetraurelia, partial (6%) [TC245297] AAATATTTATTTCTAAGAGGTGGGCTTACGAAATAAGTTATATTCAAGCGGGGCAAACGA
5 192 320 A_09_P203045 A_09_P203045 FALSE FBtr0305608 ens|FBtr0305608 chrX:11813138-11813079 dm|X10F6 TGCTTTGTCTGGAATCGCAAGACAATGCTTAAAAATTGTGGGAGGGGAATTGGTCAAAAA
6 192 318 A_09_P042931 A_09_P042931 FALSE NM_165739 NM_165739 36057 FBgn0001291 Jra Jun-related antigen fly|FBtr0088410|fly|FBtr0088411|fly|FBtr0330606|ref|NM_165739 chr2R:5985034-5985093 dm|2R46E5 Jun-related antigen [Source:FlyBase gene name;Acc:FBgn0001291] [FBtr0088410] GO:0000165(MAPK cascade)|GO:0000981(sequence-specific DNA binding RNA polymerase II transcription factor activity)|GO:0001736(establishment of planar polarity)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005667(transcription factor complex)|GO:0005737(cytoplasm)|GO:0006357(regulation of transcription from RNA polymerase II promoter)|GO:0006911(phagocytosis, engulfment)|GO:0007254(JNK cascade)|GO:0007391(dorsal closure)|GO:0007464(R3/R4 cell fate commitment)|GO:0007465(R7 cell fate commitment)|GO:0008134(transcription factor binding)|GO:0008348(negative regulation of antimicrobial humoral response)|GO:0043565(sequence-specific DNA binding)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046529(imaginal disc fusion, thorax closure)|GO:0046843(dorsal appendage formation)|GO:0046844(micropyle formation)|GO:0046982(protein heterodimerization activity)|GO:0051124(synaptic growth at neuromuscular junction) AGACGGTAAACACACCCGATTTGGAGAAGATCCTGCTATCCAACAATCTGATGCAAACAC
7 192 316 A_09_P067976 A_09_P067976 FALSE NM_132183 NM_132183 31692 FBgn0029966 Ir7c Ionotropic receptor 7c fly|FBtr0071087|fly|FBtr0309827|ref|NM_132183|tc|TC227090 chrX:7770773-7770832 dm|X7C1 Ionotropic receptor 7c [Source:FlyBase gene name;Acc:FBgn0029966] [FBtr0071087] GO:0004970(ionotropic glutamate receptor activity)|GO:0005234(extracellular-glutamate-gated ion channel activity)|GO:0016020(membrane) ACCACAAATCATCGAAGATTACGCAGGGCTTTCAATGTAATTAACAGATATGCGGCATAA
8 192 314 A_09_P165860 A_09_P165860 FALSE NM_167295 NM_167295 32119 FBgn0014133 bif bifocal fly|FBtr0073526|fly|FBtr0073527|ref|NM_167295|ref|NM_078573 chrX:11575819-11575878 dm|X10D4 bifocal [Source:FlyBase gene name;Acc:FBgn0014133] [FBtr0073526] GO:0003779(actin binding)|GO:0003824(catalytic activity)|GO:0005737(cytoplasm)|GO:0007411(axon guidance)|GO:0008017(microtubule binding)|GO:0008157(protein phosphatase 1 binding)|GO:0016052(carbohydrate catabolic process)|GO:0016321(female meiosis chromosome segregation)|GO:0030246(carbohydrate binding)|GO:0030517(negative regulation of axon extension)|GO:0051015(actin filament binding) TCTGAGAAATCTTCTATTTCCAATACCAATTCCGATTCCACTGGAGGTCATCACTCTGTT
9 192 312 A_09_P028886 A_09_P028886 FALSE NM_139501 NM_139501 38357 FBgn0035385 FR Fmrf Receptor fly|FBtr0072980|ref|NM_139501|gb|AF351129|tc|TC224015 chr3L:3011389-3011448 dm|3L63A3 Fmrf Receptor [Source:FlyBase gene name;Acc:FBgn0035385] [FBtr0072980] GO:0001653(peptide receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004985(opioid receptor activity)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0008188(neuropeptide receptor activity)|GO:0016021(integral to membrane) CAGCATTATTTAGTCGCCCTAAAAACTCAAGTAGCTCAATTTAACAGCAAATGCAACAAT
10 192 310 A_09_P153025 A_09_P153025 FALSE NM_143755 NM_143755 45250 FBgn0028969 deltaCOP delta-coatomer protein fly|FBtr0070371|fly|FBtr0301926|ref|NM_143755|ref|NM_001169171 chrX:1753239-1753180 dm|X2B12 delta-coatomer protein [Source:FlyBase gene name;Acc:FBgn0028969] [FBtr0070371] GO:0006886(intracellular protein transport)|GO:0006890(retrograde vesicle-mediated transport, Golgi to ER)|GO:0006911(phagocytosis, engulfment)|GO:0007436(larval salivary gland morphogenesis)|GO:0009306(protein secretion)|GO:0010883(regulation of lipid storage)|GO:0030126(COPI vesicle coat)|GO:0030131(clathrin adaptor complex)|GO:0035158(regulation of tube diameter, open tracheal system) TTCGTCGCACCCCTTCGATTTGAGTAATTTGTATGTAGATTGCTATGAATAAACCATATA
11 192 308 A_09_P213955 A_09_P213955 FALSE AY321364 38027 FBgn0035106 rno rhinoceros fly|FBtr0305548|fly|FBtr0072532|fly|FBtr0305549|gb|AY321364 chr3L:188060-188001 dm|3L61B2 rhinoceros [Source:FlyBase gene name;Acc:FBgn0035106] [FBtr0305548] GO:0003677(DNA binding)|GO:0005634(nucleus)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008270(zinc ion binding)|GO:0042051(compound eye photoreceptor development)|GO:0042059(negative regulation of epidermal growth factor receptor signaling pathway) CCACGCCTCCTACTCACTAAGCATGATTGATAAACCCCAGCATATATAATAAACACTATT
12 192 306 A_09_P074291 A_09_P074291 FALSE NM_141925 NM_141925 CG10035 41511 FBgn0038028 CG10035 CG10035 gene product from transcript CG10035-RA fly|FBtr0082606|ref|NM_141925|dgc|RE15080|gb|BT082039 chr3R:8207436-8207377 dm|3R87B9 This gene is referred to in FlyBase by the symbol Dmel\CG10035 (FBgn0038028). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. The biological processes in which it is involved are not known. One allele is reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of extremely high expression to a trough of no expression detected. Peak expression observed within 00-06 hour embryonic stages. [FBtr0082606] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) GTAGGTTTAGTGCTGGCTCGTAAATTAGGTGGAATGCAAAATATACTTTTAATGATGCTA
13 192 304 A_09_P033501 A_09_P033501 FALSE NM_140605 NM_140605 CG13047 39790 FBgn0036594 CG13047 CG13047 gene product from transcript CG13047-RB fly|FBtr0289964|ref|NM_140605|tc|TC238517 chr3L:16277924-16277865 dm|3L72D12 This gene is referred to in FlyBase by the symbol Dmel\CG13047 (FBgn0036594). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. The biological processes in which it is involved are not known. One allele is reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of very high expression to a trough of no expression detected. Peak expression observed within 12-24 hour embryonic stages, during early larval stages. [FBtr0289964] TACGCTGCATCCTATGCTGCTCCCATCGCCGCTGCTGCTCCAGCTCCAGTGGTGGTCTAA
14 192 302 A_09_P074511 A_09_P074511 FALSE NM_141978 NM_141978 41580 FBgn0038089 d-cup davis-cup fly|FBtr0082683|ref|NM_141978|dgc|IP07883|gb|BT132877 chr3R:8718370-8718429 dm|3R87D3 davis-cup [Source:FlyBase gene name;Acc:FBgn0038089] [FBtr0082683] GO:0005509(calcium ion binding) ATTTGATGAAGACCAAGACGGCTACATCTCATTTGAGGAGTATAGATCGATCGTGTTGCA
15 192 300 A_09_P057691 A_09_P057691 FALSE NM_166275 NM_166275 CG30114 246465 FBgn0050114 CG30114 CG30114 gene product from transcript CG30114-RA fly|FBtr0086753|ref|NM_166275|tc|TC248423 chr2R:14095740-14095799 dm|2R55B12 This gene is referred to in FlyBase by the symbol Dmel\CG30114 (FBgn0050114). It is a protein_coding_gene from Drosophila melanogaster. An electronic pipeline based on InterPro domains suggests that it has the molecular function</span>: structural constituent of ribosome. An electronic pipeline based on InterPro domains suggests that it is involved in the biological process</span>: translation. 5 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of very low expression to a trough of no expression detected. Peak expression observed during late larval stages, at stages throughout the pupal period, in adult male stages. [FBtr0086753] GO:0003735(structural constituent of ribosome)|GO:0005840(ribosome)|GO:0006412(translation) TGCACGTACGTGTAATATAACATACAATGGTATACGGGTGTACAATGGCGATGTGGGGAT
16 192 298 A_09_P202830 A_09_P202830 FALSE chr3R:014467122-014467181 dm|3R91B7 TTTTGTTATTCTTGGGCTTCTCTGATCGCCAGACAAGTACAACAACCGTTCAACCAGACG
17 192 296 A_09_P067671 A_09_P067671 FALSE NM_132107 NM_132107 CG3224 31600 FBgn0029885 CG3224 CG3224 gene product from transcript CG3224-RA fly|FBtr0070992|ref|NM_132107|dgc|RE14402|gb|AY071068 chrX:6554704-6554645 dm|X6C3 This gene is referred to in FlyBase by the symbol Dmel\CG3224 (FBgn0029885). It is a protein_coding_gene from Drosophila melanogaster. An electronic pipeline based on InterPro domains suggests that it has the molecular function</span>: zinc ion binding; nucleic acid binding. There is experimental evidence that it is involved in the biological process</span>: neurogenesis. One allele is reported. The phenotype of this allele is annotated with: trichogen cell. It has one annotated transcript and one annotated polypeptide. Protein features are: Zinc finger, C2H2; Zinc finger, C2H2-like; Zinc finger, U1-type; Zinc finger, double-stranded RNA binding. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of high expression to a trough of moderate expression. Peak expression observed within 00-12 and 18-24 hour embryonic stages, during early larval stages, in adult female stages. [FBtr0070992] GO:0003676(nucleic acid binding)|GO:0005622(intracellular)|GO:0008270(zinc ion binding)|GO:0022008(neurogenesis) AACCAATCTATTGATCTAGCTTAGTTTTTAAGGCCCTCGGGGACAGGACTTTCTTCACCC
18 192 294 A_09_P040976 A_09_P040976 FALSE NM_134581 NM_134581 CG1518 33082 FBgn0031149 CG1518 CG1518 gene product from transcript CG1518-RA fly|FBtr0077264|ref|NM_134581|dgc|LD39332|gb|BT032845 chrX:20921063-20921004 dm|X19E7 This gene is referred to in FlyBase by the symbol Dmel\CG1518 (FBgn0031149). It is a protein_coding_gene from Drosophila melanogaster. Based on sequence similarity, it is predicted to have molecular function</span>: oligosaccharyl transferase activity. There is experimental evidence that it is involved in the biological process</span>: chaeta development; wing disc development. 4 alleles are reported. The phenotype of these alleles is annotated with: mesothoracic tergum. It has one annotated transcript and one annotated polypeptide. Protein features are: Oligosaccharyl transferase, STT3 subunit. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of very high expression to a trough of moderate expression. Peak expression observed within 00-06 hour embryonic stages. [FBtr0077264] GO:0004576(oligosaccharyl transferase activity)|GO:0006486(protein glycosylation)|GO:0016020(membrane)|GO:0022416(chaeta development)|GO:0035220(wing disc development) CTGGCTTCTTAAGCAAGAAAGGAGCATGTAAGCGAATCGAACGAAATATATATATGTGGA
19 192 292 A_09_P183160 A_09_P183160 FALSE NM_167296 NM_167296 32120 FBgn0011754 PhKgamma Phosphorylase kinase gamma fly|FBtr0090002|ref|NM_167296|dgc|GH28523|gb|FJ631170 chrX:11591371-11591430 dm|X10D5 Phosphorylase kinase gamma [Source:FlyBase gene name;Acc:FBgn0011754] [FBtr0090002] GO:0004674(protein serine/threonine kinase activity)|GO:0004689(phosphorylase kinase activity)|GO:0005516(calmodulin binding)|GO:0005524(ATP binding)|GO:0005964(phosphorylase kinase complex)|GO:0005978(glycogen biosynthetic process)|GO:0006007(glucose catabolic process)|GO:0006468(protein phosphorylation)|GO:0048598(embryonic morphogenesis) ATGCATTTGTTTTCCTCGTCTTCGAGCTGTGTCCCAAAGGTGAACTCTTCGACTATCTGA
20 192 290 A_09_P067341 A_09_P067341 FALSE AY075370 Dm.85 dgc|GM14590|gb|AY075370 chrX:5659678-5659737 dm|X5B8 Drosophila melanogaster GM14590 full length cDNA. [AY075370] GGCTTGTATTTGGTCATGTTCTTCTGACTGCTAGAATGAATTTCGAGTTGGTTTTCCATC

Total number of rows: 62976

Table truncated, full table size 42174 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap