NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL17277 Query DataSets for GPL17277
Status Public on Jun 26, 2014
Title Agilent-040871 Drosophila melanogaster 8X60K with Spike (Probe Name version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Drosophila melanogaster
Manufacturer Agilent Technologies
Manufacture protocol See manufacturer's web site at http://www.agilent.com/.
 
Description Arrays of this design have barcodes that begin with 16040871 or 2540871.
 
Citation(s) 24746817
Submission date Jun 11, 2013
Last update date Jun 26, 2014
Contact name Masayuki Miura
E-mail(s) miura@mol.f.u-tokyo.ac.jp
Organization name the University of Tokyo, Grad. Sch. Pharm. Sci
Department Genetics
Street address 7-3-1, Hongo
City Bunkyo-ku
State/province Tokyo
ZIP/Postal code 1130033
Country Japan
 
Samples (22) GSM1160678, GSM1160679, GSM1160680, GSM1160681, GSM1160682, GSM1160683 
Series (2)
GSE47853 The gene expression changes in darkcd4 apoptosis-deficient mutant flies
GSE141201 Diphthamide modification of eEF2 is required for gut tumor-like hyperplasia induced by oncogenic Ras
Relations
Alternative to GPL17276

Data table header descriptions
ID Agilent Probe Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq accession
GB_ACC GenBank or RefSeq accession
ORF ORF identifier
LOCUSLINK_ID LocusLink ID
UNIGENE_ID UniGene ID
CLONE_ID Clone ID
FLYBASE_ID FlyBase ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
ACCESSION_STRING Accession string
CHROMOSOMAL_LOCATION Chromosomal location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID Go IDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC ORF LOCUSLINK_ID UNIGENE_ID CLONE_ID FLYBASE_ID GENE_SYMBOL GENE_NAME ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
A_09_P000001 A_09_P000001 FALSE NM_206326 NM_206326 CG33489 2768971 FBgn0053489 CG33489 CG33489 gene product from transcript CG33489-RA fly|FBtr0089525|ref|NM_206326|dgc|AT04621|gb|BT001271 chr3L:11567981-11567922 dm|3L68C13 This gene is referred to in FlyBase by the symbol Dmel\CG33489 (FBgn0053489). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. The biological processes in which it is involved are not known. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of moderately high expression to a trough of no expression detected. Peak expression observed in adult male stages. [FBtr0089525] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) CATCTGTCGCACAGTTTCGTGCTGCAATGAACTGCGAAATGCATGCATCTACATAAAAAA
A_09_P000006 A_09_P000006 FALSE NM_206325 NM_206325 CG33490 2768970 FBgn0053490 CG33490 CG33490 gene product from transcript CG33490-RA fly|FBtr0089526|ref|NM_206325|dgc|LP11159|gb|AY118618 chr3L:11566032-11565973 dm|3L68C13 This gene is referred to in FlyBase by the symbol Dmel\CG33490 (FBgn0053490). It is a protein_coding_gene from Drosophila melanogaster. An electronic pipeline based on InterPro domains suggests that it has the molecular function</span>: calcium ion binding. The biological processes in which it is involved are not known. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of moderately high expression to a trough of no expression detected. Peak expression observed during late pupal stages, in adult male stages. [FBtr0089526] GO:0005509(calcium ion binding)|GO:0005575(cellular_component)|GO:0008150(biological_process) CGTTGCACAATTTCGTGCTCAGATGAAGAAGAACATTGAATCATAATTCAAGTTAGGTTT
A_09_P000016 A_09_P000016 FALSE NM_206316 NM_206316 CG33493 2768994 FBgn0053493 CG33493 CG33493 gene product from transcript CG33493-RA fly|FBtr0089606|ref|NM_206316|dgc|MIP03833|gb|BT058064 chr3L:10685974-10685915 dm|3L67E7 This gene is referred to in FlyBase by the symbol Dmel\CG33493 (FBgn0053493). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. The biological processes in which it is involved are not known. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of very high expression to a trough of low expression. Peak expression observed within 18-24 hour embryonic stages, during late larval stages, at stages throughout the pupal period. [FBtr0089606] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) AGATACCAGGCCAAACTGCATCTACACCATGACTATAAGACCAATGCGTATCCCTCGTAA
A_09_P000021 A_09_P000021 FALSE NM_206572 NM_206572 CG33494 2768686 FBgn0053494 CG33494 CG33494 gene product from transcript CG33494-RA fly|FBtr0089607|ref|NM_206572|dgc|LP10657|gb|BT003551 chr3R:21319396-21319337 dm|3R96E2 This gene is referred to in FlyBase by the symbol Dmel\CG33494 (FBgn0053494). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. The biological processes in which it is involved are not known. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of moderately high expression to a trough of extremely low expression. Peak expression observed during early pupal stages. [FBtr0089607] GTTTACTGAGTCAGAATCTTGGAGTCGCCATGATCAGTCGCATTGAAATATTTATTTTTA
A_09_P000026 A_09_P000026 FALSE NM_206793 2768886 FBgn0053499 Sdic4 Sperm-specific dynein intermediate chain 4 fly|FBtr0089612|fly|FBtr0089610|fly|FBtr0089409|fly|FBtr0089408 chrX:20076167-20076108 dm|X19C1 Sperm-specific dynein intermediate chain 4 [Source:FlyBase gene name;Acc:FBgn0053499] [FBtr0089612] GO:0003777(microtubule motor activity)|GO:0005858(axonemal dynein complex)|GO:0007018(microtubule-based movement)|GO:0019861(flagellum) CTGCAAAATTCTCTAGATGACCACAGTAACTGTACTAGAAGTTTTATTCAATGAAACTCG
A_09_P000031 A_09_P000031 FALSE NM_206090 NM_206090 2768720 FBgn0053503 Cyp12d1-d CG33503 gene product from transcript CG33503-RA fly|FBtr0089418|fly|FBtr0089419|ref|NM_206090|ref|NM_136791 chr2R:7011435-7011376 dm|2R47D4 Cyp12d1-d [Source:FlyBase gene name;Acc:FBgn0053503] [FBtr0089418] GO:0005739(mitochondrion)|GO:0009055(electron carrier activity)|GO:0016705(oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen)|GO:0020037(heme binding)|GO:0055114(oxidation-reduction process) ATGTTCCTCATGGAACCGGCCATTACGTTCCCCTTCAAATTCACGGATATCGAACAATAA
A_09_P000036 A_09_P000036 FALSE NM_001014529 NM_001014529 3346176 FBgn0053505 U3-55K U3 small nuclear riboprotein factor 55K fly|FBtr0091445|ref|NM_001014529|dgc|LD17611|gb|AY118520 chr2R:10746482-10746423 dm|2R51C5 U3 small nuclear riboprotein factor 55K [Source:FlyBase gene name;Acc:FBgn0053505] [FBtr0091445] GO:0003729(mRNA binding)|GO:0006364(rRNA processing)|GO:0022008(neurogenesis)|GO:0030532(small nuclear ribonucleoprotein complex)|GO:0034511(U3 snoRNA binding) GCGCGGCCAGCAGTTAGGTTAACTTCTAAGCTTAAGTAAAGTTGTATAGTTTTTGTAACA
A_09_P000041 A_09_P000041 FALSE NM_001014528 NM_001014528 CG33506 3346177 FBgn0053506 CG33506 CG33506 gene product from transcript CG33506-RA fly|FBtr0091446|ref|NM_001014528|dgc|RH47216|gb|BT031299 chr2R:10745041-10744982 dm|2R51C5 This gene is referred to in FlyBase by the symbol Dmel\CG33506 (FBgn0053506). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. The biological processes in which it is involved are not known. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of moderately high expression to a trough of moderate expression. Peak expression observed within 00-06 hour embryonic stages, during early larval stages, during late pupal stages, in adult female stages. [FBtr0091446] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) GCGCAACAGCCTGAAACAGAGTAAACACACATTTATTGTTACATTTTTATTGCCGGTTGA
A_09_P000046 A_09_P000046 FALSE NM_001169474 NM_001169474 3346227 FBgn0261871 dpr2 CG33507 gene product from transcript CG33507-RB fly|FBtr0306116|fly|FBtr0306117|ref|NM_001169474|ref|NM_001014480 chr2L:10917839-10917780 dm|2L32B4 This gene is referred to in FlyBase by the symbol Dmel\dpr2 (CG33507, FBgn0261871). It is a protein_coding_gene from Drosophila melanogaster. Its molecular function is unknown. Based on sequence similarity, it is predicted to be involved in the biological process</span>: sensory perception of chemical stimulus. 7 alleles are reported. No phenotypic data is available. It has 2 annotated transcripts and 2 annotated polypeptides. Protein features are: Immunoglobulin I-set; Immunoglobulin V-set; Immunoglobulin subtype; Immunoglobulin subtype 2; Immunoglobulin-like; Immunoglobulin-like fold. Gene sequence location is 2L:10917139..10964128. [FBtr0306116] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0007606(sensory perception of chemical stimulus) CATATCAATTATTGCAACCTGCGTGCGAAAATCACCAGCCACTTGAAGGAGCATCGATGT
A_09_P000051 A_09_P000051 FALSE NM_001014495 NM_001014495 3346226 FBgn0053508 ppk13 pickpocket 13 fly|FBtr0091448|ref|NM_001014495|gb|AY226544|tc|TC229467 chr2L:21086959-21086900 dm|2L39A1 pickpocket 13 [Source:FlyBase gene name;Acc:FBgn0053508] [FBtr0091448] GO:0005272(sodium channel activity)|GO:0006814(sodium ion transport)|GO:0016020(membrane) ACGTATATTAACGAGAAACGTCGACTAAAGCGATTGATTATACCCAAGAGATTTCAATGA
A_09_P000056 A_09_P000056 FALSE NM_001014494 NM_001014494 CG33509 3346225 FBgn0053509 CG33509 CG33509 gene product from transcript CG33509-RA fly|FBtr0091449|ref|NM_001014494|dgc|IP21282|gb|BT032794 chr2L:21084786-21084727 dm|2L39A1 This gene is referred to in FlyBase by the symbol Dmel\CG33509 (FBgn0053509). It is a protein_coding_gene from Drosophila melanogaster. An electronic pipeline based on InterPro domains suggests that it has the molecular function</span>: transferase activity, transferring phosphorus-containing groups. The biological processes in which it is involved are not known. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Protein features are: CHK kinase-like; Protein kinase-like domain; Protein of unknown function DUF227. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of low expression to a trough of no expression detected. Peak expression observed during late pupal stages, in stages of adults of both sexes. [FBtr0091449] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) AAACCCAGAATTCGCTACATATATGGAGGAGTGCTGTGTGGATGTCATGGAAATGGCCTT
A_09_P000061 A_09_P000061 FALSE NM_001014493 NM_001014493 CG33510 3346224 FBgn0053510 CG33510 CG33510 gene product from transcript CG33510-RB fly|FBtr0300360|ref|NM_001014493 chr2L:21082948-21082889 dm|2L39A1 This gene is referred to in FlyBase by the symbol Dmel\CG33510 (FBgn0053510). It is a protein_coding_gene from Drosophila melanogaster. An electronic pipeline based on InterPro domains suggests that it has the molecular function</span>: transferase activity, transferring phosphorus-containing groups. The biological processes in which it is involved are not known. One allele is reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Protein features are: CHK kinase-like; Protein kinase-like domain; Protein of unknown function DUF227. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of moderate expression to a trough of no expression detected. Peak expression observed during early larval stages. [FBtr0300360] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) GATTATATGTATGACTGTGTGGGTGACTTACTGGCACTGACATATCATAAACTACACTGA
A_09_P000066 A_09_P000066 FALSE NM_001014492 NM_001014492 CG33511 3346223 FBgn0053511 CG33511 CG33511 gene product from transcript CG33511-RA fly|FBtr0091451|ref|NM_001014492|tc|NP1344415|tc|TC229706 chr2L:21081186-21081127 dm|2L39A1 This gene is referred to in FlyBase by the symbol Dmel\CG33511 (FBgn0053511). It is a protein_coding_gene from Drosophila melanogaster. An electronic pipeline based on InterPro domains suggests that it has the molecular function</span>: transferase activity, transferring phosphorus-containing groups. The biological processes in which it is involved are not known. 3 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Protein features are: CHK kinase-like; Protein kinase-like domain; Protein of unknown function DUF227. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of very low expression to a trough of no expression detected. Peak expression observed within 00-06 hour embryonic stages, during early larval stages, during early pupal stages, in stages of adults of both sexes. [FBtr0091451] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) ATGACGCCTATCAGGGAACTGGTGGATTACCTCATGGAGAATGAGAATTTATATATTTAG
A_09_P000071 A_09_P000071 FALSE NM_001014616 NM_001014616 3346160 FBgn0053512 dpr4 CG33512 gene product from transcript CG33512-RB fly|FBtr0300491|fly|FBtr0300492|ref|NM_001014616|ref|NM_001170118 chr3R:7360325-7360266 dm|3R86E8 dpr4 [Source:FlyBase gene name;Acc:FBgn0053512] [FBtr0300491] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0007606(sensory perception of chemical stimulus) ACATCAACTGGAACTGGAGCCCCGACTGGCGCTGGCACTGGAACCCTAAATGGAATTGGA
A_09_P000076 A_09_P000076 FALSE AY616148 31107 Dm.14391 Nmdar2 NMDA receptor 2 gb|AY616148|gb|AY616145|gb|AY050491|gb|AY616144 chrX:1380321-1380255 dm|X2B1 Drosophila melanogaster NMDA receptor subunit 2-2 mRNA, complete cds. [AY616148] GO:0004970(ionotropic glutamate receptor activity)|GO:0004972(N-methyl-D-aspartate selective glutamate receptor activity)|GO:0005234(extracellular-glutamate-gated ion channel activity)|GO:0006811(ion transport)|GO:0016020(membrane)|GO:0030288(outer membrane-bounded periplasmic space) CAGAATCCAGAATCCACAATCCAGAATAAAGAACTAAGGCCAGATATGCAGCCCAGAAAA
A_09_P000081 A_09_P000081 FALSE NM_001014558 NM_001014558 CG33514 3346239 FBgn0053514 CG33514 CG33514 gene product from transcript CG33514-RA fly|FBtr0091456|ref|NM_001014558|dgc|LP22879|gb|BT012303 chr3L:4366609-4366668 dm|3L64B2 This gene is referred to in FlyBase by the symbol Dmel\CG33514 (FBgn0053514). It is a protein_coding_gene from Drosophila melanogaster. Based on sequence similarity, it is predicted to have molecular function</span>: vitamin E binding. There is experimental evidence that it is involved in the biological process</span>: neurogenesis. 2 alleles are reported. No phenotypic data is available. It has one annotated transcript and one annotated polypeptide. Protein features are: CRAL-TRIO domain; CRAL/TRIO, N-terminal domain; Cellular retinaldehyde binding/alpha-tocopherol transport. Summary of modENCODE Temporal Expression Profile: Temporal profile ranges from a peak of moderately high expression to a trough of very low expression. Peak expression observed within 12-24 hour embryonic stages, at stages throughout the larval period, during early pupal stages, in stages of adults of both sexes. [FBtr0091456] GO:0008431(vitamin E binding)|GO:0022008(neurogenesis) GATAATATAGGAATACATGAATATGCTACGATACTTCGCAGCAGTTTTAGGTTTCTCCTA
A_09_P000086 A_09_P000086 FALSE tc|TC224960 chr2L:14911994-14911935 dm|2L35B7 Rep: CG33515-PA - Drosophila melanogaster (Fruit fly), complete [TC224960] GO:0003725(double-stranded RNA binding)|GO:0003779(actin binding)|GO:0005509(calcium ion binding)|GO:0005635(nuclear envelope)|GO:0005737(cytoplasm)|GO:0007010(cytoskeleton organization)|GO:0007015(actin filament organization)|GO:0007303(cytoplasmic transport, nurse cell to oocyte)|GO:0007498(mesoderm development)|GO:0008092(cytoskeletal protein binding)|GO:0008305(integrin complex)|GO:0008335(female germline ring canal stabilization)|GO:0015629(actin cytoskeleton)|GO:0030018(Z disc)|GO:0040023(establishment of nucleus localization) TCCAAGTGGTCACCCAATGGCAATGTAAGTACACAAACATGCGATTGTTCCAGTGGGAAA
A_09_P000091 A_09_P000091 FALSE NM_001014459 NM_001014459 3346208 FBgn0053516 dpr3 CG33516 gene product from transcript CG33516-RB fly|FBtr0300671|ref|NM_001014459|dgc|RH14432|dgc|IP06940 chr2L:2066757-2066554 dm|2L22C2 dpr3 [Source:FlyBase gene name;Acc:FBgn0053516] [FBtr0300671] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0007606(sensory perception of chemical stimulus)|GO:0032234(regulation of calcium ion transport via store-operated calcium channel activity) TCTGCATGATAAATCGGTATCCTGGATACGGAAACGTGATCTGCATATCCTGACTGTAGG
A_09_P000096 A_09_P000096 FALSE NM_001014759 NM_001014759 33007 FBgn0053517 D2R Dopamine 2-like receptor fly|FBtr0070034|ref|NM_001014759|dgc|RE06088|gb|BT015236 chrX:19899034-19898975 dm|X19A4 Dopamine 2-like receptor [Source:FlyBase gene name;Acc:FBgn0053517] [FBtr0070034] GO:0001591(dopamine receptor activity, coupled via Gi/Go)|GO:0004930(G-protein coupled receptor activity)|GO:0004952(dopamine receptor activity)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007212(dopamine receptor signaling pathway)|GO:0008227(G-protein coupled amine receptor activity)|GO:0016021(integral to membrane) CTCTACCAATAAAGCATATATACGAGTTTGTAAGATAACTGGGGTGTAAGCGAAAATGAA
A_09_P000101 A_09_P000101 FALSE NM_001014758 33007 FBgn0053517 D2R Dopamine 2-like receptor fly|FBtr0091461|fly|FBtr0100196|fly|FBtr0091462|fly|FBtr0070033 chrX:19901051-19900992 dm|X19A4 Dopamine 2-like receptor [Source:FlyBase gene name;Acc:FBgn0053517] [FBtr0091461] GO:0001591(dopamine receptor activity, coupled via Gi/Go)|GO:0004930(G-protein coupled receptor activity)|GO:0004952(dopamine receptor activity)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007212(dopamine receptor signaling pathway)|GO:0008227(G-protein coupled amine receptor activity)|GO:0016021(integral to membrane) TTATCAACGGCGAGCACGTCACCAGCAATAGTTATAGCAATAGGCAATTGGATGATGGGT

Total number of rows: 32298

Table truncated, full table size 21443 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap