NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL18860 Query DataSets for GPL18860
Status Public on Oct 02, 2014
Title NIA Drosophila microarray
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Drosophila melanogaster
Manufacturer Laboratory of Experimantal Gerontology, National Institute on Aging
Manufacture protocol PCR products of 14,151 predicted or known genes in D. melanogaster were used to generate DNA microarray. The length of each PCR amplicon was 100-600 bp. cDNA was amplified with universal primers (AATGCAGGTTAACCTGGCTTATCG and AACGCGGCTACAATTAATACATAACC). PCR products were printed on 3-D slides (Full Moon Biosystems Inc.).
 
 
Submission date Jun 24, 2014
Last update date Jun 24, 2014
Contact name Sige Zou
E-mail(s) zous@mail.nih.gov
Phone 410-558-8461
Organization name National Institute on Aging
Department Translational Gerontology Branch
Lab Zou lab
Street address 251 Bayview Blvd
City Baltiimore
State/province MD
ZIP/Postal code 21224
Country USA
 
Samples (8) GSM1419308, GSM1419309, GSM1419310, GSM1419311, GSM1419312, GSM1419313 
Series (1)
GSE58778 Mitochondrial ATP Synthase Subunit d Interacts with TOR Signaling and Dietary Macronutrients to Modulate Proteostasis and Lifespan in Drosophila

Data table header descriptions
ID
Block the block number of the feature
Column the column number of the feature
Row the row number of the feature
Name
ID_number
SPOT_ID

Data table
ID Block Column Row Name ID_number SPOT_ID
1 1 1 1 1-Z49777_1 01: D-01 1-Z49777_1
2 1 2 1 7-Q9LU32_1 01: D-13 7-Q9LU32_1
3 1 3 1 11-X64464_1 01: H-01 11-X64464_1
4 1 4 1 18-O04513_1 01: H-13 18-O04513_1
5 1 5 1 20-O49366_1 01: L-01 20-O49366_1
6 1 6 1 13-U74610_1 01: L-13 13-U74610_1
7 1 7 1 11-O81842_1 01: P-01 11-O81842_1
8 1 8 1 14-ATU18126_1 01: P-13 14-ATU18126_1
9 1 9 1 22-Q9LJQ4_1 02: D-01 22-Q9LJQ4_1
10 1 10 1 15-O04600_1 02: D-13 15-O04600_1
11 1 11 1 12-Q9XIB8_1 02: H-01 12-Q9XIB8_1
12 1 12 1 14-Q9LZJ2_2 02: H-13 14-Q9LZJ2_2
13 1 13 1 16-L22585_1 02: L-01 16-L22585_1
14 1 14 1 1-CG9075-RB_00718-00956_4 02: L-13 1-CG9075-RB_00718-00956_4
15 1 15 1 3-AB007987_1 02: P-01 3-AB007987_1
16 1 16 1 AutoBlank 02: P-13 --AutoBlank
17 1 17 1 2-CG3841-RA_2 03: D-01 2-CG3841-RA_2
18 1 18 1 18-CG3894-RB_5 03: D-13 18-CG3894-RB_5
19 1 19 1 15-CG3995-RA_4 03: H-01 15-CG3995-RA_4
20 1 1 2 9-CG40068-RA_1 03: H-13 9-CG40068-RA_1

Total number of rows: 16416

Table truncated, full table size 812 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap