NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL20727 Query DataSets for GPL20727
Status Public on Jul 23, 2015
Title NimbleGen marine metagenome array [XM_Nov2012_RMB]
Technology type in situ oligonucleotide
Distribution non-commercial
Organism marine metagenome
Manufacturer NimbleGen
Manufacture protocol ITO coated glass slides
 
Description 25 bp probes targeting the 16S rRNA of uncultivated microbes of mixed microbial communities
 
Submission date Jul 22, 2015
Last update date Jul 23, 2015
Contact name Xavier Mayali
E-mail(s) mayali1@llnl.gov
Phone 925-423-3892
Organization name Lawrence Livermore National Laboratory
Department Chemical Science
Street address 7000 East Ave
City Livermore
State/province CA
ZIP/Postal code 94550
Country USA
 
Samples (17) GSM1830997, GSM1830998, GSM1830999, GSM1831000, GSM1831001, GSM1831002 
Series (1)
GSE71228 Chip-SIP analysis of Monterey Bay surface waters incubated with organic carbon substrates

Data table header descriptions
ID
subarray subarray
sequence probe sequence
taxon taxon

Data table
ID subarray sequence taxon
acido_1_8_Marbact Marbact AATTCCGCATCCCTCTCCCGGCTTC acido1
acido_1_11_Marbact Marbact GAATTCCGCATCCCTCTCCCGGCTT acido1
acido1_1_Marbact Marbact AAACCTAGATCCGTCATCCCACACG acido1
acido1_27_Marbact Marbact AACCTAGATCCGTCATCCCACACGC acido1
acido1_9_Marbact Marbact ACAAACCTAGATCCGTCATCCCACA acido1
acido_1_12_Marbact Marbact GGAATTCCGCATCCCTCTCCCGGCT acido1
acido1_8_Marbact Marbact TTACAAACCTAGATCCGTCATCCCA acido1
acido1_7_Marbact Marbact TACAAACCTAGATCCGTCATCCCAC acido1
acido1_11_Marbact Marbact GAATTCCGCATCCCTCTCCCGGCTT acido1
acido1_2_Marbact Marbact CAAACCTAGATCCGTCATCCCACAC acido1
acido_2_18_Marbact Marbact CCCCATTGACAAAAATTCCCCACTG acido2
acido_2_27_Marbact Marbact CCCCCATTGACAAAAATTCCCCACT acido2
acido_2_30_Marbact Marbact CCCATTGACAAAAATTCCCCACTGC acido2
acido_2_17_Marbact Marbact CAGTCCCCTCAGAGTGCTCAGCATT acido2
acido_2_23_Marbact Marbact CGATACCCGCCACACCAAGTGCTCA acido2
acido_2_26_Marbact Marbact TCGATACCCGCCACACCAAGTGCTC acido2
acido_2_24_Marbact Marbact GTCGATACCCGCCACACCAAGTGCT acido2
acido_2_9_Marbact Marbact AGGCCCCGAAGGGTCCCCAGCTTTG acido2
acido_2_8_Marbact Marbact GGCCCCGAAGGGTCCCCAGCTTTGA acido2
acido_2_25_Marbact Marbact GGTCGATACCCGCCACACCAAGTGC acido2

Total number of rows: 4318

Table truncated, full table size 268 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL20727_XM_Nov2012_RMB.ndf.gz 6.7 Mb (ftp)(http) NDF

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap