 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 31, 2019 |
| Title |
Agilent-085072 FZ_IBG1_4plex_085072_Corynebacterium |
| Technology type |
in situ oligonucleotide |
| Distribution |
custom-commercial |
| Organisms |
Gluconobacter oxydans; Escherichia coli; Corynebacterium glutamicum; Pseudomonas putida KT2440; Bacillus subtilis subsp. subtilis str. 168 |
| Manufacturer |
Agilent Technologies (Waldbronn, Germany). |
| Manufacture protocol |
See Agilent Technologies web site.
|
| |
|
| Description |
Corynebacterium glutamicum (NC_006958), Bacillus subtilis str. 168 (NC_000964), Gluconobacter oxydans (NC_006677, NC_006672, NC_006673, NC_006674, NC_006675, NC_006676), Escherichia coli (NC_000913), Pseudomonas putiida KT2440 (NC_002947)
|
| |
|
| Submission date |
Jul 12, 2019 |
| Last update date |
Aug 02, 2019 |
| Contact name |
Tino Polen |
| E-mail(s) |
t.polen@fz-juelich.de
|
| Organization name |
Forschungszentrum Jülich GmbH
|
| Department |
IBG-1: Biotechnology
|
| Street address |
Leo Brandt Str.
|
| City |
Juelich |
| State/province |
NRW |
| ZIP/Postal code |
52425 |
| Country |
Germany |
| |
|
| Samples (6) |
GSM3939045, GSM3939046, GSM3939047, GSM4568820, GSM4568821, GSM4568822 |
| Series (2) |
| GSE134218 |
Transcriptome analysis of C. glutamicum ΔaceE Δpyc versus ΔaceE |
| GSE151224 |
Comparison of Corynebacterium glutamicum ATCC 13032 + pAN6-cg1978 with ATCC 13032 + pAN6 |
|
| Data table header descriptions |
| ID |
|
| Block |
GenePix GAL spot position Block coordinate |
| Column |
GenePix GAL spot position Column coordinate |
| Row |
GenePix GAL spot position Row coordinate |
| Name |
Spot Name (oligo or control name) |
| SEQUENCE |
Oligo_Sequence |
| Cglutamicum_Gene_Annotation |
Cglutamicum_Gene_Annotation |
| Cglutamicum_Locus_Tag |
Cglutamicum_Lous_Tag |
| ORF |
C. glutamicum locus tag |
| SPOT_ID |
|
| Data table |
| ID |
Block |
Column |
Row |
Name |
SEQUENCE |
Cglutamicum_Gene_Annotation |
Cglutamicum_Locus_Tag |
ORF |
SPOT_ID |
| 1 |
1 |
1 |
1 |
GE_BrightCorner |
|
|
|
|
--GE_BrightCorner |
| 2 |
1 |
2 |
1 |
GE_BrightCorner |
|
|
|
|
--GE_BrightCorner |
| 3 |
1 |
3 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 4 |
1 |
4 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 5 |
1 |
5 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 6 |
1 |
6 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 7 |
1 |
7 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 8 |
1 |
8 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 9 |
1 |
9 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 10 |
1 |
10 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 11 |
1 |
11 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 12 |
1 |
12 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 13 |
1 |
13 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 14 |
1 |
14 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 15 |
1 |
15 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 16 |
1 |
16 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 17 |
1 |
17 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 18 |
1 |
18 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 19 |
1 |
19 |
1 |
DarkCorner |
|
|
|
|
--DarkCorner |
| 20 |
1 |
20 |
1 |
GEOCGc32591463 |
GATCGCGCGTCGTCAGCTTCCGCTGTCTGGCCGCAGCCCTCAGATTTCCATC |
"pccB, propionyl-CoA carboxylase beta chain" |
cg3177 |
cg3177 |
|
Total number of rows: 45220
Table truncated, full table size 2284 Kbytes.
| Supplementary file |
Size |
Download |
File type/resource |
| GPL26911_FZ_IBG1_4plex_085072_Corynebacterium.gal.gz |
347.8 Kb |
(ftp)(http) |
GAL |
|
|
|
|
 |
