NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL27751 Query DataSets for GPL27751
Status Public on Apr 01, 2020
Title FDA-EVIR GeneChip Tiling Array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organisms Bacillus subtilis; unidentified adenovirus; Rotavirus; Coxsackievirus; Hepatovirus A; Sapovirus; Norovirus; Astrovirus sp.; Paslahepevirus balayani
Manufacturer Affymetrix
Manufacture protocol Affymetrix
 
 
Submission date Nov 13, 2019
Last update date Apr 01, 2020
Contact name Christine Fang Yu
E-mail(s) Christine.Yu@fda.hhs.gov
Phone 1-301-796-0643
Organization name US Food and Drug Administration
Department Center for Food Safety and Applied Nutrition
Lab Office of Applied Research and Safety Assessment
Street address 8301 Muirkirk Rd.
City Laurel
State/province MD
ZIP/Postal code 20708
Country USA
 
Samples (17) GSM4159749, GSM4159750, GSM4159751, GSM4159752, GSM4159753, GSM4159754 
Series (1)
GSE140351 Capability of FDA-EVIR Microarray for Detection of Norovirus and Hepatitis A Virus in Inoculated Tomatoes, Green Onions, and Celery

Data table header descriptions
ID
Sequence Name
nt Position
SEQUENCE
X
Y
Gene Group
Subtype Group

Data table
ID Sequence Name nt Position SEQUENCE X Y Gene Group Subtype Group
15689 Ade:14-Jun-07;AdenovirusT032244 0 ATGGCCACCCCATCGATGATGCCGC 84 47 adenovirus
15688 Ade:14-Jun-07;AdenovirusT032244 2 GGCCACCCCATCGATGATGCCGCAG 83 47 adenovirus
23523 Ade:14-Jun-07;AdenovirusT032244 4 CCACCCCATCGATGATGCCGCAGTG 282 70 adenovirus
106854 Ade:14-Jun-07;AdenovirusT032244 6 ACCCCATCGATGATGCCGCAGTGGT 281 321 adenovirus
20196 Ade:14-Jun-07;AdenovirusT032244 8 CCCATCGATGATGCCGCAGTGGTCT 275 60 adenovirus
97128 Ade:14-Jun-07;AdenovirusT032244 10 CATCGATGATGCCGCAGTGGTCTTA 183 292 adenovirus
97127 Ade:14-Jun-07;AdenovirusT032244 12 TCGATGATGCCGCAGTGGTCTTACA 182 292 adenovirus
45765 Ade:14-Jun-07;AdenovirusT032244 14 GATGATGCCGCAGTGGTCTTACATG 280 137 adenovirus
7778 Ade:14-Jun-07;AdenovirusT032244 16 TGATGCCGCAGTGGTCTTACATGCA 141 23 adenovirus
40359 Ade:14-Jun-07;AdenovirusT032244 18 ATGCCGCAGTGGTCTTACATGCACA 186 121 adenovirus
40358 Ade:14-Jun-07;AdenovirusT032244 20 GCCGCAGTGGTCTTACATGCACATC 185 121 adenovirus
30804 Ade:14-Jun-07;AdenovirusT032244 22 CGCAGTGGTCTTACATGCACATCGC 259 92 adenovirus
72396 Ade:14-Jun-07;AdenovirusT032244 24 CAGTGGTCTTACATGCACATCGCCG 19 218 adenovirus
72393 Ade:14-Jun-07;AdenovirusT032244 26 GTGGTCTTACATGCACATCGCCGGC 16 218 adenovirus
109472 Ade:14-Jun-07;AdenovirusT032244 28 GGTCTTACATGCACATCGCCGGCCA 243 329 adenovirus
100109 Ade:14-Jun-07;AdenovirusT032244 30 TCTTACATGCACATCGCCGGCCAGG 176 301 adenovirus
23309 Ade:14-Jun-07;AdenovirusT032244 32 TTACATGCACATCGCCGGCCAGGAC 68 70 adenovirus
21116 Ade:14-Jun-07;AdenovirusT032244 34 ACATGCACATCGCCGGCCAGGACGC 199 63 adenovirus
9818 Ade:14-Jun-07;AdenovirusT032244 36 ATGCACATCGCCGGCCAGGACGCCT 189 29 adenovirus
9817 Ade:14-Jun-07;AdenovirusT032244 38 GCACATCGCCGGCCAGGACGCCTCG 188 29 adenovirus

Total number of rows: 105527

Table truncated, full table size 9163 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL27751_FDA-EVIR_Annotation.csv.gz 1.5 Mb (ftp)(http) CSV
GPL27751_FDA_EVIRb520474F-3.bpmap.gz 995.8 Kb (ftp)(http) BPMAP
GPL27751_FDA_EVIRb520474F.cif.gz 814 b (ftp)(http) CIF
GPL27751_FDA_EVIRb520474F.grc.gz 4.9 Kb (ftp)(http) GRC

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap