NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL27953 Query DataSets for GPL27953
Status Public on Dec 27, 2019
Title [Agilent-068823] Agilent USC-Acuigen Perkinsus olseni 15 K v 1.0 ID-068823
Technology type spotted oligonucleotide
Distribution custom-commercial
Organism Perkinsus olseni
Manufacturer Agilent and Acuigen group, Dpto de Zoología, Genética y Antropología Física,Facultad Veterinaria, Campus de Lugo, Universidade de Santiago de Compostela
Manufacture protocol We selected 10,104 sequences from our previously published P. olseni trophozoite transcriptome (Hasanuzzaman et al., 2016). A total of 9,369 sequences were selected because they were annotated to transcripts in the NCBI nr protein database, while the remaining 735 non-annotated sequences were selected by their notable differential expression in our preliminary evaluation (Hasanuzzaman et al., 2016). One oligo-probe was designed for annotated sequences (known sense) and two probes (sense and antisense) were designed for the non-annotated sequences. We also included 4,158 technical replicates for microarray reproducibility evaluation. The probes were synthesized in a random layout using the Agilent methodology.
 
 
Submission date Dec 27, 2019
Last update date Dec 27, 2019
Contact name Belen G Pardo
E-mail(s) belen.gomez@usc.es
Phone +34 982822428
Organization name University of Santiago de Compostela
Department Zoology, Genetics and Physical Anthropology
Lab Acuigen
Street address Avda. Carballo Calero s/n
City LUGO
State/province LUGO
ZIP/Postal code 27002
Country Spain
 
Samples (16) GSM4237423, GSM4237424, GSM4237425, GSM4237426, GSM4237427, GSM4237428 
Series (2)
GSE142665 New insights into the Manila clam – Perkinsus olseni interaction based on gene expression analysis of clam hemocytes and parasite trophozoites through in vitro challenges [Perkinsus olseni]
GSE142666 New insights into the Manila clam – Perkinsus olseni interaction based on gene expression analysis of clam hemocytes and parasite trophozoites through in vitro challenges

Data table header descriptions
ID
Row Row of the matrix
Col Column of the matrix
ControlType Control probe: 1 or -1; Non-control probe: 0
ProbeName Probe name
SEQUENCE Sequence of the probe oligo (for non-control probes)
Ref_seq_Anot Protein accession number of the annotating sequence
Annotation Sequence annotation
SPOT_ID

Data table
ID Row Col ControlType ProbeName SEQUENCE Ref_seq_Anot Annotation SPOT_ID
1 1 1 1 GE_BrightCorner --GE_BrightCorner
2 1 2 1 DarkCorner --DarkCorner
3 1 3 1 DarkCorner --DarkCorner
4 1 4 0 comp5622_c0_seq2_2 ATGAAGTTAAGTTGGATCCGACCAGTGAACTACGCACGTGTTTTGAGGGAGTCCT ref|XP_002772916.1| 26S protease regulatory subunit, putative [Perkinsus marinus ATCC 50983] gb|EER04732.1| 26S protease regulatory subunit, putative [Perkinsus marinus ATCC 50983] XP_002772916.1
5 1 5 0 comp9751_c0_seq1reverse_2 ATTTCTACCTCGGCAAGCGTATCGCCTACGTTTACAAGACCAACACCCTCAAGAA ref|XP_002771672.1| 60S ribosomal protein L35a, putative [Perkinsus marinus ATCC 50983] ref|XP_002787925.1| 60S ribosomal protein L35a, putative [Perkinsus marinus ATCC 50983] gb|EER03488.1| 60S ribosomal protein L35a, putative [Perkinsus marinus ATCC 50983] gb|EER19721.1| 60S ribosomal protein L35a, putative [Perkinsus marinus ATCC 50983] XP_002771672.1
6 1 6 0 comp6062_c0_seq1_2 TATTGGGATACTTTCGACGGCCAGACGATTCGTATACTGGAAGGATCGGAAACCG ref|XP_002786170.1| WD-repeat protein, putative [Perkinsus marinus ATCC 50983] gb|EER17966.1| WD-repeat protein, putative [Perkinsus marinus ATCC 50983] XP_002786170.1
7 1 7 0 comp7747_c0_seq1_1 GGCAGTAGGTTTTGTTCTTGCTAATAGTGTACGAATAGTGATCCTGTTCTCGAGATC ref|XP_002780982.1| uridine phosphorylase, putative [Perkinsus marinus ATCC 50983] gb|EER12777.1| uridine phosphorylase, putative [Perkinsus marinus ATCC 50983] XP_002780982.1
8 1 8 0 comp4666_c0_seq1reverse_1 TTTCTGTATACGAGAGACCTACACAGTGCGCCAAGTACACCGGGTCATTAAGGCC ref|XP_002783523.1| conserved hypothetical protein [Perkinsus marinus ATCC 50983] gb|EER15319.1| conserved hypothetical protein [Perkinsus marinus ATCC 50983] XP_002783523.1
9 1 9 0 comp4488_c0_seq1_1 CCACTCCATTCCCATCTCCTATCATTACAGTATGAACGGCTAACATAACAGGATTA ref|XP_002775334.1| 5 transmembrane domain protein, putative [Perkinsus marinus ATCC 50983] gb|EER07150.1| 5 transmembrane domain protein, putative [Perkinsus marinus ATCC 50983] XP_002775334.1
10 1 10 0 comp11539_c0_seq1_1 CGGCATCAAGTTGGAAGATATGAAACAGGTTGTCGACAAAATGGAGCCTCTCGAG ref|XP_002773131.1| Phosphoserine phosphatase, putative [Perkinsus marinus ATCC 50983] gb|EER04947.1| Phosphoserine phosphatase, putative [Perkinsus marinus ATCC 50983] XP_002773131.1
11 1 11 0 comp6242_c1_seq1_1 GTGCTTTTGACTATAATGTCAACACAACGACTGTTGGTAGAAGAAAGGCTGTTGA ref|XP_002772411.1| step II splicing factor slu7, putative [Perkinsus marinus ATCC 50983] gb|EER04227.1| step II splicing factor slu7, putative [Perkinsus marinus ATCC 50983] XP_002772411.1
13 1 13 0 comp6182_c0_seq1reverse_1 ACCCTTGGTAGAGTAGCTGACCTAAATTGATACCTTCCGACGTTTCTAACCTTCA ref|XP_002779075.1| oxalate:formate antiporter, putative [Perkinsus marinus ATCC 50983] gb|EER10870.1| oxalate:formate antiporter, putative [Perkinsus marinus ATCC 50983] XP_002779075.1
14 1 14 0 comp7304_c0_seq1reverse_2 GAGGGCTGCTACCGACATCGTCCTGGAGTTGATTGTCTATACTAACGAGTGTTTC ref|XP_002768692.1| conserved hypothetical protein [Perkinsus marinus ATCC 50983] gb|EER01410.1| conserved hypothetical protein [Perkinsus marinus ATCC 50983] XP_002768692.1
15 1 15 0 Contig1515reverse_2 TGAGCACGTGAAGATCTCAGCATGATCATTTCTTTCCGCGTAATGTGTTTCTGCT ref|XP_002765337.1| hypothetical protein Pmar_PMAR016132 [Perkinsus marinus ATCC 50983] gb|EEQ98054.1| hypothetical protein Pmar_PMAR016132 [Perkinsus marinus ATCC 50983] XP_002765337.1
16 1 16 0 comp14946_c0_seq1_2 CCTCGTAAACAGAATTGTGCGGTAATCAGATTTACTAACCCTACTAAGGCCACTTGC ref|XP_002782411.1| TATA-box factor binding protein, putative [Perkinsus marinus ATCC 50983] gb|EER14206.1| TATA-box factor binding protein, putative [Perkinsus marinus ATCC 50983] XP_002782411.1
17 1 17 0 comp8779_c0_seq8reverse_2 TGACGATCTTGCATCTCTTCCATGTTTCCGATAATACGAAATTCACGTTTCCGAA ref|XP_002773682.1| hypothetical protein Pmar_PMAR011524 [Perkinsus marinus ATCC 50983] gb|EER05498.1| hypothetical protein Pmar_PMAR011524 [Perkinsus marinus ATCC 50983] XP_002773682.1
18 1 18 0 comp12190_c0_seq1reverse_1 CAGAGTGCGCTTGCTCACTCACATACTTCTACGCCTACGACGTCTATTCCTATTT comp12190_c0_seq1reverse_1
19 1 19 0 comp12257_c0_seq1_2 GCCATCGAGTCTTTCTACAGTGGTTATAGAGACCCTATCAAGGCAGCTGGAGAGC ref|XP_002774254.1| apoptosis inhibitor, putative [Perkinsus marinus ATCC 50983] gb|EER06070.1| apoptosis inhibitor, putative [Perkinsus marinus ATCC 50983] XP_002774254.1
20 1 20 0 comp758185_c0_seq1_1 GTTTTGCAAAGAGGAAGTTTATGGATAAAAGTTTATCTGCACCCGGACAATAGGG gb|ELT90587.1| hypothetical protein CAPTEDRAFT_171381 [Capitella teleta] ELT90587.1
21 1 21 0 Contig918_2 ATGATGAAGTCAGAAAATGTCTTTCGACGTTGCAGAGTATTAACCCGTCCCTCGG ref|XP_002786065.1| conserved hypothetical protein [Perkinsus marinus ATCC 50983] gb|EER17861.1| conserved hypothetical protein [Perkinsus marinus ATCC 50983] XP_002786065.1

Total number of rows: 15325

Table truncated, full table size 3859 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap