NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL3051 Query DataSets for GPL3051
Status Public on Jan 07, 2006
Title UBEC Array3
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Escherichia coli
Manufacturer UBEC, School of Biosciences, University of Birmingham, Birmingham, UK
Manufacture protocol The 70-mer oligonucleotide array was constructed, containing 6112 oligonucleotides that sampled chromosomal genes identified in the genome sequences of E. coli strains K-12 MG1655, O157:H7 VT2 Sakai, and O157:H7 EDL933 and plasmid genes from the two genome-sequenced O157:H7 strains (the Operon Array Ready E. coli Oligonucleotide™ set 1.0, Qiagen- Operon, Hilden, Germany). 12 positive and 12 negative control oligonucleotides were also included. The oligonucleotides were resuspended in Corning Pronto! buffer and printed on to Corning UltraGAPS™ slides (Corning B.V Life Sciences, Schiphol-Rijk, Netherlands ) using a Biorobotics Microgrid TAS array printer. Amersham Lucidea Universal Scorecard™ controls (GE Healthcare, Little Chalfont, UK) were printed in each subarray. Slides were desiccated under vacuum for 48 hours and then U.V. cross-linked with a dose of 600mJ using a Stratalinker (Stratagene limited, U.K.). Slides were stored under desiccating conditions in the dark until use
 
 
Contributor(s) Constantinidou C, Hobman JL, Penn CW, Patel M, Jones AC
Submission date Nov 07, 2005
Last update date Apr 26, 2011
Contact name Chrystala Constantinidou
E-mail(s) C.Constantinidou@bham.ac.uk
Phone +44 (0)121 414 5564
Organization name University of Birmingham
Department School of Biosciences
Lab UBEC
Street address
City Birmingham
ZIP/Postal code B15 2TT
Country United Kingdom
 
Samples (94) GSM83053, GSM83054, GSM83055, GSM83056, GSM83057, GSM83058 
Series (14)
GSE3591 A reassesment of the FNR regulon and the effects of nitrate,nitrite, narXL and narQP
GSE6296 Analysis of the exression and regulation of NleA-E in Escherichia coli O157:H7
GSE6781 The NsrR regulon of Escherichia coli K-12

Data table header descriptions
ID
Array Block Block (subarray) number
Array Col Column number (within subarray)
Array Row Row number (within subarray)
Operon Oligo_ID ID of Operon Array_Ready Oligo
PT_GI Protein GenBank Identifier
SPOT_ID identifier for control spots
Control ID Name of control spots
Plate Source plate number
Plate Row Row in source plate
Plate Column Column in source plate
SEQUENCE Operon Oligonucleotide Sequence
MG1655 K12 ORF Name E.coli K12 MG1655 ORF name
MG1655 K12 Gene Symbol E.coli K12 MG1655 gene name
MG1655 K12 Map E.coli K12 MG1655 chromosome gene coordinates
MG1655 K12 DBid E.coli K12 MG1655 database ID information
MG1655 K12 Product E.coli K12 MG1655 gene product description
O157 EDL933 ORF Name E.coli O157 EDL 933 ORF name
O157 EDL933 Gene Symbol E.coli O157 EDL 933 gene name
O157 EDL933 Map E.coli O157 EDL 933 chromosome gene coordinates
O157 EDL933 DBid E.coli O157 EDL 933 database ID information
O157 EDL933 Product E.coli O157 EDL 933 gene product description
O157 Sakai ORF Name E.coli O157 Sakai ORF name
O157 Sakai Gene Symbol E.coli O157 Sakai gene name
O157 Sakai Map E.coli O157 Sakai chromosome gene coordinates
O157 Sakai DBid E.coli O157 Sakai database ID information
O157 Sakai Product E.coli O157 Sakai gene product description
pO157 ORF Name E.coli O157 Sakai pO157 ORF name
pO157 Gene Symbol E.coli O157 Sakai pO157 gene name
pO157 Map E.coli O157 Sakai pO157 chromosome gene coordinates
pO157 DBid E.coli O157 Sakai pO157 database ID information
pO157 Product E.coli O157 Sakai pO157 gene product description

Data table
ID Array Block Array Col Array Row Operon Oligo_ID PT_GI SPOT_ID Control ID Plate Plate Row Plate Column SEQUENCE MG1655 K12 ORF Name MG1655 K12 Gene Symbol MG1655 K12 Map MG1655 K12 DBid MG1655 K12 Product O157 EDL933 ORF Name O157 EDL933 Gene Symbol O157 EDL933 Map O157 EDL933 DBid O157 EDL933 Product O157 Sakai ORF Name O157 Sakai Gene Symbol O157 Sakai Map O157 Sakai DBid O157 Sakai Product pO157 ORF Name pO157 Gene Symbol pO157 Map pO157 DBid pO157 Product
1 1 1 1 E100000014 Cntrl:dnaK Cntrl:dnaK 1 A 12 GGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAGCGATTATGGATGGCACCACTCCT null null null null null null null null null null null null null null null null null null null null
2 1 1 2 E100001264 1787550 null 5 E 12 CGGGATGAAATGATCATGAGCGCAATCCGCCATATGATATTGCCCGTGATCACCCTGTCGGTTGCGCCAA b1293 sapB complement(1352529..1353494) GI:1787550; PID:g1787550 putative transport; Not classified Z2496 sapB 2223768..2224733 GI:12515484 homolog of Salmonella peptide transport permease protein ECs1870 sapB complement(1862438..1863403) GI:13361335 homolog of Salmonella peptide transport permease protein null null null null null
3 1 1 3 E100005064 13360969 null 15 E 12 CGGCAGGGTTCAACTTTAACTATGCAGCAGGTTTTTGTTCCGCTACCCCGGCGTTAAGGGGATATGAGGT null null null null null Z1769 Z1769 complement(1629292..1629522) GI:12514680 unknown protein encoded by prophage CP-933N ECs1505 ECs1505 complement(1544196..1544426) GI:13360969 hypothetical protein null null null null null
4 1 1 4 E100001294 1787583 null 5 I 24 CAGTTAAAGAACGCTATCTATCGCGCACTGACACAACTGGACGGTTATGAGCTGCGTCCACAGGATATTT b1323 tyrR 1384744..1386285 GI:1787583; PID:g1787583 regulator; Transport of small molecules: Amino acids, amines Z2454 tyrR complement(2191092..2192633) GI:12515443 transcriptional regulation of aroF, aroG, tyrA and aromatic amino acid transport ECs1902 tyrR 1894534..1896075 GI:13361367 transcription regulator tyrR null null null null null
5 1 1 5 E100002030 1788386 null 7 E 24 CTGGATGTATACGCGCGGGGATAAAATTTACGGCGGTTATACCATTGATCCTTTATTGGTCACCTATCCA b2071 b2071 2149207..2149668 GI:1788386; PID:g1788386 orf; Unknown null null null null null null null null null null null null null null null
6 1 1 6 E100000908 1787164 null 4 I 12 GCTGAAATTCAGGAAGACACGCGAATGATGTTTCAGGATGCGCGTCTGCTACCGTGGAAATCGGTGATTG b0933 ycbE complement(992500..993267) GI:1787164; PID:g1787164 putative transport; Not classified Z1281 ycbE complement(1211971..1212738) GI:12514108 putative ATP-binding component of a transport system ECs1016 ycbE complement(1122748..1123515) GI:13360475 putative ATP-binding component of a transport system null null null null null
7 1 1 7 E100003954 1790497 null 12 I 24 CCATCAGAAAATTATTCAGGATCTTATCGCATGGATTGACGAGCATATTGACCAGCCGCTTAACATTGAT b4062 soxS complement(4274639..4274962) GI:1790497; PID:g1790497 regulator; Global regulatory functions Z5661 soxS complement(5160191..5160514) GI:12519016 regulation of superoxide response regulon ECs5044 soxS complement(5130206..5130529) GI:13364521 regulation of superoxide response regulon null null null null null
8 1 1 8 E100000124 1786316 null 2 E 12 TCACGCTCAACCCGTTCCTCTCACCATTTGGTCTGCCATGTAAACAGCCAGCATGGGGTTATATCTCGGC b0124 gcd complement(138835..141225) GI:1786316; PID:g1786316 enzyme; Degradation of small molecules: Carbon compounds Z0134 gcd complement(143208..145598) GI:12512839 glucose dehydrogenase ECs0128 gcd complement(143207..145597) GI:13359584 glucose dehydrogenase null null null null null
9 1 1 9 E100002808 1789236 null 9 I 12 TTGGCAAAGCGCCGGTTGTTGATAAGTGGACCTTCTCAACTAACGGCGTATCTATCATGGGCCGTCACGG b2872 ygeY 3006785..3007996 GI:1789236; PID:g1789236 putative enzyme; Not classified Z4211 ygeY 3814401..3815612 GI:12517393 putative deacetylase ECs3745 ygeY 3747095..3748306 GI:13363217 putative deacetylase null null null null null
10 1 1 10 E100004732 13360279 null 14 M 12 TTCGGCGCAAGCTTGATAATGGTGGTCGGGTGTTCGTCAAAGGAAAATGCCCTGTGCCATCCTCAGACGA null null null null null Z0961 Z0961 904163..904630 GI:12513726 putative endopeptidase protein Rz of prophage CP-933K ECs0820 ECs0820 902515..902982 GI:13360279 putative endopeptidase null null null null null
11 1 1 11 E100000558 1786780 null 3 M 24 GGGATCTTCACCGATCCTCAGTCATATATTACTTACGCGACCGCGCTGGCTTATCGTGGCGAAAAAGCAC b0568 nfrA complement(587205..590177) GI:1786780; PID:g1786780 membrane; Phage-related functions and prophages Z0698 nfrA complement(658833..661805) GI:12513441 bacteriophage N4 receptor, outer membrane protein ECs0600 nfrA complement(659139..662111) GI:13360058 bacteriophage N4 adsorption protein NfrA null null null null null
12 1 1 12 E100005872 12518920 null 17 M 12 GTTTAACGATCAACCGATGCAGTGCGCCGCCGGGCAAACTGTTCACGAACTACTGGAGCAACTCGTTCAA null null null null null Z5566 thiS complement(5070208..5070408) GI:12518920 thiamin biosynthesis, probable sulfur donor null null null null null null null null null null
13 1 1 13 E100002006 1788360 null 7 A 24 GATGGCAAGCCGATCAAAGTGTGGAAGTTCCGTTCCATGAAAGTGATGGAGAACGACAAAGTGGTGACCC b2047 wcaJ complement(2118182..2119576) GI:1788360; PID:g1788360 putative enzyme; Not classified Z3211 wcaJ complement(2865658..2867052) GI:12516238 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase ECs2852 wcaJ complement(2795444..2796838) GI:13362320 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase null null null null null
14 1 1 14 E100005848 13364142 null 17 I 12 CTACCATTCCGTCAGTAATTACATTCAGCGCGACATCATGGCATTACGTAGCCAGATTATGATTGGCGAT null null null null null Z5222 Z5222 complement(4769618..4772152) GI:12518578 putative fimbrial usher ECs4667 ECs4667 complement(4700637..4703171) GI:13364142 putative outer membrane usher protein precursor null null null null null
15 1 1 15 E100002048 1788405 null 7 I 12 TTATATCGAATGTGATTACAATCGGTGGCGGCGGCACAGTTGGTGTGGCGGCCTCAGTCCGGAACAATTT b2089 tra5_4 2168554..2169420 GI:1788405; PID:g1788405 IS, phage, Tn; Transposon-related functions null null null null null null null null null null null null null null null
16 1 1 16 E100002766 1789193 null 9 A 24 AAATACATCCCCTCCGTAAAAGAAGAACGTTTCCGCGCGTTTTTAGGCGTACCAATTATTCAACGTCGCC b2829 ptsP complement(2964210..2966456) GI:1789193; PID:g1789193 enzyme; Transport of small molecules: Other Z4146 ptsP complement(3755886..3758132) GI:12517314 PTS system, enzyme I, transcriptional regulator (with NPR and NTR proteins) ECs3686 ptsP complement(3688588..3690834) GI:13363158 PTS system transcriptional regulator enzyme I null null null null null
17 1 1 17 E100000014 Cntrl:dnaK Cntrl:dnaK 1 A 12 GGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAGCGATTATGGATGGCACCACTCCT null null null null null null null null null null null null null null null null null null null null
18 1 2 1 E100000014 Cntrl:dnaK Cntrl:dnaK 1 A 12 GGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAGCGATTATGGATGGCACCACTCCT null null null null null null null null null null null null null null null null null null null null
19 1 2 2 E100005468 13362312 null 16 I 12 TGGGAATGCATCGGCCTTCTTTTTTGGTCCTTTTCTCTCCGTATTGATAATGTGTACTCCTCTGATCTTA null null null null null Z3203 wzy complement(2855525..2856709) GI:12516227 O antigen polymerase ECs2844 wzy complement(2785311..2786495) GI:13362312 O antigen polymerase null null null null null
20 1 2 3 E100001620 1787939 null 6 A 12 TTCTCCTTCTTCAAACCATCGTACCGATCAGTACGGCGGCAGCGTGGAAAATCGCGCACGTTTGGTACTG b1650 nemA 1724683..1725780 GI:1787939; PID:g1787939 enzyme; Central intermediary metabolism: Pool, multipurpose conversions Z2668 nemA 2401579..2402676 GI:12515645 unknown ECs2359 nemA 2326385..2327482 GI:13361826 N-ethylmaleimide reductase null null null null null

Total number of rows: 14400

Table truncated, full table size 4487 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap