NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5161 Query DataSets for GPL5161
Status Public on Mar 27, 2008
Title Bacillus cereus ATCC 14579 amplicon-based 12k microarray
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Bacillus cereus ATCC 14579
Manufacturer MolGen, Groningen
Manufacture protocol Amplicon based DNA-microarrays were constructed for B. cereus ATCC 14579 as described for Lactococcus lactis IL1403 (Kuipers et al., 2002; van Hijum et al., 2005) with modifications as detailed below. Amplicons were designed on 5199 genes selected from the 5311 annotated genes (ORFs smaller than 80 bp were omitted) on the genome of B. cereus ATCC 14579 (Ivanova et al., 2003). To reduce cross-hybridization between probe and target DNA sequences the amplicons had sizes of 70 – 700 bp (depending on gene sizes) and comprised the most unique part of a gene. The amplicons were synthesized by EuroGentec (Seraing, Belgium) in two amplification steps. In the first amplification step, primers were used with a unique tag-sequence for B. cereus ATCC 14579 (forward primers were extended with the sequence: 5’-TCGGGCAGCTGCTCC-3’; and reverse primers with the sequence: 5’-TGGCGCCCCTAGATG -3’). Two copies of each amplicon were present per array, resulting in microarrays comprising 10398 spots.
 
 
Contributor(s) van der Voort M, Abee T, Kuipers OP, de Jong A
Submission date May 14, 2007
Last update date Mar 27, 2008
Contact name Menno van der Voort
Organization name Wageningen UR
Department Agrotechnology and Food Sciences Group
Lab Food Microbiology
Street address Bomenweg 2
City Wageningen
ZIP/Postal code 6703 HD
Country Netherlands
 
Samples (21) GSM189695, GSM189722, GSM189723, GSM189724, GSM189725, GSM189726 
Series (2)
GSE7843 Assessment of CcpA-mediated catabolite control of metabolism and enterotoxin production in Bacillus cereus ATCC 14579
GSE9846 Anaerobic induction in B. cereus ATCC 14579

Data table header descriptions
ID
GR Grid Row
GC Grid Column
SR Subgrid Row
SC Subgrid Row
Description RZC number as found in ERGO and ERGO light database
ForwardPrimer_seq forward primer sequence used to obtain amplicon
ReversePrimer_seq reverse primer sequence used to obtain amplicon
GENOME_ACC Bacillus cereus ATCC 14579 RefSeq accession.version
SPOT_ID spot identifer

Data table
ID GR GC SR SC Description ForwardPrimer_seq ReversePrimer_seq GENOME_ACC SPOT_ID
Plate 5 [bc384.05] Well P4 [RZC02960]_1 1 1 1 1 RZC02960 GACGTTAACCCTGGTCC GTGAACCATGACCACTATTTG NC_004722.1 ERGOproteinID_RZC02960
Plate 5 [bc384.05] Well L1 [RZC02924]_1 1 1 1 2 RZC02924 GATTATGTAACACCTCACGTTG TATACGTTGGTGTGCGTTT NC_004722.1 ERGOproteinID_RZC02924
Plate 5 [bc384.05] Well D22 [RZC02996]_1 1 1 1 3 RZC02996 TAGGAAACGCTCAAACTGTAG TAGGGAGTAGCATTGTGGTAA NC_004722.1 ERGOproteinID_RZC02996
Plate 4 [bc384.04] Well P19 [RZC02574]_1 1 1 1 4 RZC02574 GGGAATTACGAGTTTCATAGTC CGCGATTATCGTCTGTAGTA NC_004722.1 ERGOproteinID_RZC02574
Plate 4 [bc384.04] Well L16 [RZC02537]_1 1 1 1 5 RZC02537 ACATTTCAATGACCAAGGAC ACCTTTATCGACAGCTTTACAC NC_004722.1 ERGOproteinID_RZC02537
Plate 4 [bc384.04] Well H13 [RZC02496]_1 1 1 1 6 RZC02496 AGTAGGATCTCCTGGTAGAGGT CTGCACTTAATTGCGTTCTAC NC_004722.1 ERGOproteinID_RZC02496
Plate 4 [bc384.04] Well D10 [RZC02331]_1 1 1 1 7 RZC02331 GAACGATACGCACGAAAG GCATCCCCATGATGTTT NC_004722.1 ERGOproteinID_RZC02331
Plate 3 [bc384.03] Well P7 [RZC01858]_1 1 1 1 8 RZC01858 TCTTTGTACTTGCTGGATGTAG CCACTAATCGCTTCATATCAC NC_004722.1 ERGOproteinID_RZC01858
Plate 3 [bc384.03] Well L4 [RZC01815]_1 1 1 1 9 RZC01815 TAAGCTAGAACAAGGTGACGTA GCTTCATCTCCTAAAGCAGTAA NC_004722.1 ERGOproteinID_RZC01815
Plate 3 [bc384.03] Well H1 [RZC01765]_1 1 1 1 10 RZC01765 TAGGATTAGAGACTGAAGCTGG AAGTTTGGTTCTGAGAATGC NC_004722.1 ERGOproteinID_RZC01765
Plate 2 [bc384.02] Well P22 [RZC01402]_1 1 1 1 11 RZC01402 CACCGTACGTATGATGAGC GTTTCATGTGAAAGAGCTGAC NC_004722.1 ERGOproteinID_RZC01402
Plate 2 [bc384.02] Well L19 [RZC01354]_1 1 1 1 12 RZC01354 GGGAGTGAGGTTTGCTAAG GATATAACGTCATTCCACCATC NC_004722.1 ERGOproteinID_RZC01354
Plate 2 [bc384.02] Well H16 [RZC01317]_1 1 1 1 13 RZC01317 ATATCGCACATAGAGGTGCTT GTTAATGTTGGGACTTTTGC NC_004722.1 ERGOproteinID_RZC01317
Plate 2 [bc384.02] Well D13 [RZC01279]_1 1 1 1 14 RZC01279 CAAAAACAAGTTAGCAGTCG CGTCTTCAATACGGTATGTT NC_004722.1 ERGOproteinID_RZC01279
Plate 1 [bc384.01] Well P10 [RZC00607]_1 1 1 1 15 RZC00607 CTCCATTAAAGCGCAGAG CTTTACAGAGAGAACGAAACCT NC_004722.1 ERGOproteinID_RZC00607
Plate 1 [bc384.01] Well L7 [RZC00552]_1 1 1 1 16 RZC00552 AAACCAGGTAAAGCCTATGAC GGGAATAACACAGCTAAGAAAC NC_004722.1 ERGOproteinID_RZC00552
Plate 1 [bc384.01] Well H4 [RZC00514]_1 1 1 1 17 RZC00514 GTAGGAAAAACACACAGCG ATCTCTTATTTGGGGTAGGG NC_004722.1 ERGOproteinID_RZC00514
Plate 1 [bc384.01] Well D1 [RZC00458]_1 1 1 1 18 RZC00458 TTATGAAGGTGAAAAGTGGG GTATACAACTGTTCCGCGAT NC_004722.1 ERGOproteinID_RZC00458
Plate 5 [bc384.05] Well P7 [RZC02963]_1 1 1 2 1 RZC02963 GCAATTTAGTAGAGTGCATACG TCTACTGTATCCATAGCTTCTCG NC_004722.1 ERGOproteinID_RZC02963
Plate 5 [bc384.05] Well L4 [RZC02927]_1 1 1 2 2 RZC02927 TTTGACGTACAGCAAAAGG CAACTACGCTCATTCCTTCTA NC_004722.1 ERGOproteinID_RZC02927

Total number of rows: 11664

Table truncated, full table size 1442 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap