NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7372 Query DataSets for GPL7372
Status Public on Sep 26, 2008
Title LC Sciences_miRNA_Human_v9(1).1
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer LC Sciences
Manufacture protocol Microarrays designed for genome-wide microRNA expression profiling and built on the flexible and powerful µParaflo® microfluidic on-chip synthesis platform. The current probe content comes from version 9.1 of the miRBase sequence database. This version has been updated (see GPL6668)
Support glass
Coating unknown
 
Description This platform contain probes for the human 470 miRNA described in miRBase v9.1
 
Web link http://www.lcsciences.com/products/genomics/mirna_microarray/mirna_array_content/human_array_content.html
Contributor(s) Malumbres R, Lossos IS
Submission date Sep 25, 2008
Last update date Sep 26, 2008
Contact name Raquel Malumbres
E-mail(s) rmalumbres@yahoo.com
Phone +34 948194700
Organization name University of Navarra/ Clínica Universidad de Navarra
Department Hemato-Oncology
Lab Multiple Myeloma
Street address Avenida Pio XII 55
City Pamplona
State/province Navarra
ZIP/Postal code 31008
Country Spain
 
Samples (18) GSM324446, GSM324447, GSM324448, GSM324449, GSM324450, GSM324451 
Series (2)
GSE12934 miRNA profiles of tonsilar B and T lymphocytes
GSE26346 Differential expression of microRNAs between eutopic and ectopic endometrium in ovarian endometriosis

Data table header descriptions
ID
SEQUENCE Sequence of the target miRNA
SPOT ID Control or experimental spot
miRNA_ID Name of the target microRNA
INDEX Position in the array
SPOT_ID

Data table
ID SEQUENCE SPOT ID miRNA_ID INDEX SPOT_ID
hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU experimental hsa-let-7a 1
hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU experimental hsa-let-7b 2
hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU experimental hsa-let-7c 3
hsa-let-7d AGAGGUAGUAGGUUGCAUAGU experimental hsa-let-7d 4
hsa-let-7e UGAGGUAGGAGGUUGUAUAGU experimental hsa-let-7e 5
hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU experimental hsa-let-7f 6
hsa-let-7g UGAGGUAGUAGUUUGUACAGU experimental hsa-let-7g 7
hsa-let-7i UGAGGUAGUAGUUUGUGCUGU experimental hsa-let-7i 8
hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA experimental hsa-miR-1 9
hsa-miR-100 AACCCGUAGAUCCGAACUUGUG experimental hsa-miR-100 10
hsa-miR-101 UACAGUACUGUGAUAACUGAAG experimental hsa-miR-101 11
hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA experimental hsa-miR-103 12
hsa-miR-105 UCAAAUGCUCAGACUCCUGU experimental hsa-miR-105 13
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC experimental hsa-miR-106a 14
hsa-miR-106b UAAAGUGCUGACAGUGCAGAU experimental hsa-miR-106b 15
hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA experimental hsa-miR-107 16
hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG experimental hsa-miR-10a 17
hsa-miR-10b UACCCUGUAGAACCGAAUUUGU experimental hsa-miR-10b 18
hsa-miR-122a UGGAGUGUGACAAUGGUGUUUGU experimental hsa-miR-122a 19
hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA experimental hsa-miR-124a 20

Total number of rows: 523

Table truncated, full table size 31 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL7372_Array_Layout.txt.gz 2.9 Kb (ftp)(http) TXT
GPL7372_Data_Layout.txt.gz 38.5 Kb (ftp)(http) TXT
GPL7372_Sequence_List.txt.gz 9.8 Kb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap