|
Status |
Public on Dec 14, 2009 |
Title |
Gene expression data from AP-2γ silenced MCF-7 cells |
Organism |
Homo sapiens |
Experiment type |
Expression profiling by array
|
Summary |
Overexpression of the AP-2γ transcription factor in breast tumours has been identified as an independent predictor of poor outcome and failure of hormone therapy, even in ER positive, ErbB2 negative tumours; markers of a more favourable prognosis. To understand further the role of AP-2γ in breast carcinoma, we have used an RNA interference and gene expression profiling strategy using the MCF-7 cell line as a model for ER positive, ErbB2 negative tumours with AP-2γ overexpression. Gene expression changes between control and silenced cells implicate AP-2γ in the control of cell cycle progression and developmental signalling.
Keywords: RNA interference
|
|
|
Overall design |
We compared the expression profiles of MCF-7 cells separately transfected with three independent AP-2γ targeting sequences with those from control cells treated with transfection reagent alone or a non-silencing control siRNA on Affymetrix arrays; each condition was examined in triplicate.
|
|
|
Contributor(s) |
Hurst HC, Williams CM |
Citation(s) |
19798054 |
|
Submission date |
Mar 31, 2009 |
Last update date |
Mar 25, 2019 |
Contact name |
Helen C Hurst |
E-mail(s) |
h.c.hurst@qmul.ac.uk
|
Organization name |
Institute of Cancer
|
Department |
Centre for Tumour Biology
|
Street address |
Charterhouse Square
|
City |
London |
ZIP/Postal code |
EC1M 6BQ |
Country |
United Kingdom |
|
|
Platforms (1) |
GPL570 |
[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array |
|
Samples (15)
|
GSM388424 |
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 1 |
GSM388425 |
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 2 |
GSM388426 |
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 3 |
GSM388427 |
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 1 |
GSM388428 |
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 2 |
GSM388429 |
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 3 |
GSM388430 |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 1 |
GSM388431 |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 2 |
GSM388432 |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 3 |
GSM388433 |
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 1 |
GSM388434 |
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 2 |
GSM388435 |
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 3 |
GSM388436 |
Transfection Reagent Only Technical Replicate 1 |
GSM388437 |
Transfection Reagent Only Technical Replicate 2 |
GSM388438 |
Transfection Reagent Only Technical Replicate 3 |
|
Relations |
BioProject |
PRJNA115925 |