|
| Status |
Public on Dec 14, 2009 |
| Title |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 2 |
| Sample type |
RNA |
| |
|
| Source name |
siRNA treated MCF-7 breast carcinoma cell line
|
| Organism |
Homo sapiens |
| Characteristics |
protocol: AP-2 gamma targetting siRNA 3
cell line: MCF7
|
| Treatment protocol |
Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
|
| Growth protocol |
MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
|
| Label |
biotin
|
| Label protocol |
Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
|
| |
|
| Hybridization protocol |
15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
|
| Scan protocol |
Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
|
| Description |
AP-2 gamma silenced
|
| Data processing |
The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
|
| |
|
| Submission date |
Mar 31, 2009 |
| Last update date |
Aug 28, 2018 |
| Contact name |
Helen C Hurst |
| E-mail(s) |
h.c.hurst@qmul.ac.uk
|
| Organization name |
Institute of Cancer
|
| Department |
Centre for Tumour Biology
|
| Street address |
Charterhouse Square
|
| City |
London |
| ZIP/Postal code |
EC1M 6BQ |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL570 |
| Series (1) |
| GSE15481 |
Gene expression data from AP-2γ silenced MCF-7 cells |
|
| Relations |
| Reanalyzed by |
GSE119087 |
