|
| Status |
Public on Jun 09, 2021 |
| Title |
Transcriptionally regulated energy metabolism drives early erythropoiesis (RRBS) |
| Organism |
Danio rerio |
| Experiment type |
Methylation profiling by high throughput sequencing
|
| Summary |
Transcription and metabolism both influence cell function yet dedicated transcriptional control of metabolic pathways that regulate cell fate has rarely been defined. Through a chemical suppressor screen, we discovered that inhibition of the pyrimidine biosynthesis enzyme DHODH rescues erythroid differentiation in bloodless moonshine mutant embryos defective for the transcription elongation factor tif1γ. This rescue depends on the functional link of DHODH to mitochondrial respiration. TIF1γ directly controls coenzyme Q synthesis gene expression. Upon tif1γ loss, coenzyme Q levels are reduced, and a high succinate/α-ketoglutarate ratio leads to increased histone methylation. A coenzyme Q analogue rescues moonshine’s bloodless phenotype. These results demonstrate mitochondrial metabolism is a key output of a lineage transcription factor that drives cell fate decisions in the early blood lineage.
|
| |
|
| Overall design |
tif1γ (ENSDART00000020116.9/NM_001002871.2) was knocked down (tif1γ KD) by injecting 1 ng of an ATG-blocking morpholino (Gene Tools, 5’→3’ morpholino sequence ATCTTGGCCTTTGTTGTCCGCCATC) into zebrafish wild-type (TU) embryos at the 1-2 cell stage. As a control (Ctrl KD), 1 ng of a Standard Control oligo (designed by Gene Tools, 5’→3’ morpholino sequence CCTCTTACCTCAGTTACAATTTATA) was injected into zebrafish embryos at the 1-2 cell stage. tif1γ KD and Ctrl KD embryos from each clutch were harvested at 11 hpf, 22 hpf and 48 hpf by snap-freezing them, followed by extraction of genomic DNA and processing for reduced representation bisulfite sequencing (RRBS).
|
| |
|
| Contributor(s) |
Rossmann MP, Hetzel S, Weigert R, Yang S, Meissner A, Zon LI |
| Citation(s) |
33986176 |
| |
| Submission date |
Dec 18, 2020 |
| Last update date |
Jun 09, 2021 |
| Contact name |
Leonard Zon |
| E-mail(s) |
zon@enders.tch.harvard.edu
|
| Organization name |
Boston Children's Hospital
|
| Department |
Oncology/Hematology
|
| Street address |
1 Blackfan Circle
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL24995 |
Illumina NovaSeq 6000 (Danio rerio) |
|
| Samples (12)
|
|
| This SubSeries is part of SuperSeries: |
| GSE136456 |
Transcriptionally regulated energy metabolism drives early erythropoiesis |
|
| Relations |
| BioProject |
PRJNA686370 |
| SRA |
SRP298452 |
Less...
More...