|
| Status |
Public on Mar 24, 2006 |
| Title |
100nM Scrambled oligo transfection replicate 2 |
| Sample type |
RNA |
| |
|
| Source name |
E14TG2a mouse embroyonic stem cells (ATCC, CRL-1841)
|
| Organism |
Mus musculus |
| Characteristics |
mouse embryonic stem cell
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Mouse embryonic stem cells were transfected with 100nM Scrambled (Ambion; AGACUAGCGGUAUCUUUAUCCC) oligomer using Lipofectamine 2000 (Invitorgen protocol) and total RNA extracted after 72h using TRIzol reagent (Invitrogen) and further purified by Rneasy column (Qiagen;#75144).
|
| Label |
biotin
|
| Label protocol |
First & Second strand cDNA synthesis, cRNA Biotin-labelling and cRNA purification were performed using the Illumina TotalPrepRNA Amplification kit (Ambion;#IL1791). 850ng labeled cRNA were mixed with Hyb Mix (Hyb E1+Formamide) as according to instructions in BeadStation 500X Gene Expression System (Illumina) and used for microarray (Illumina Mouse Refseq-8 Array) staining.
|
| |
|
| Hybridization protocol |
All Hybridisation and Wash procedures were performed following instructions in the Experienced User Card #2, Hybridize/Wash 8-sample BeadChip protocol (Illumina). Briefly, 34ul of the Hyb mix with labeled cRNA sample was dispensed onto the center of each array and allowed to hyb with rotations in a pre-heated oven for 16-20h at 55*C. Washes were done with Wash E1BC solution, Block E1 solution was used for blocking and detection performed by Block E1 solution+Streptavidin-Cy3/5.
|
| Scan protocol |
standard Illumina procedures
|
| Description |
100nM Scrambled oligo transfection replicate 2
|
| Data processing |
RMA normalization
|
| |
|
| Submission date |
Mar 21, 2006 |
| Last update date |
Mar 21, 2008 |
| Contact name |
Bing Lim |
| E-mail(s) |
limb1@gis.a-star.edu.sg
|
| Phone |
+65 64788156
|
| Fax |
+65 64789005
|
| URL |
http://www.gis.a-star.edu.sg
|
| Organization name |
Genome Institute of Singapore
|
| Department |
Stem Cell and Developmental Biology
|
| Lab |
Stem Cell and Developmental Biology
|
| Street address |
60 Biopolis street, #02-01 Genome
|
| City |
Singapore |
| State/province |
Singapore |
| ZIP/Postal code |
138672 |
| Country |
Singapore |
| |
|
| Platform ID |
GPL4865 |
| Series (1) |
| GSE4522 |
MicroRNA-134 Modulates Mouse Embryonic Stem Cell Differentiation |
|
