NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM104063 Query DataSets for GSM104063
Status Public on Apr 08, 2006
Title 100nM Scrambled oligo transfection plus 100nM RA treatment, 48hr, replicate 1
Sample type RNA
 
Source name E14TG2a mouse embroyonic stem cells (ATCC, CRL-1841)
Organism Mus musculus
Characteristics mouse embryonic stem cell
Extracted molecule total RNA
Extraction protocol Mouse embryonic stem cells were transfected with 100nM Scrambled (Ambion; AGACUAGCGGUAUCUUUAUCCC) oligomer using Lipofectamine 2000 (Invitorgen protocol), 100nM all-trans retinoic acid induction started 24h post-transfection and total RNA extracted after 48h using TRIzol reagent (Invitrogen) and further purified by Rneasy column (Qiagen;#75144).
Label biotin
Label protocol First & Second strand cDNA synthesis, cRNA Biotin-labelling and cRNA purification were performed using the Illumina TotalPrepRNA Amplification kit (Ambion;#IL1791). 850ng labeled cRNA were mixed with Hyb Mix (Hyb E1+Formamide) as according to instructions in BeadStation 500X Gene Expression System (Illumina) and used for microarray (Illumina Mouse Refseq-8 Array) staining.
 
Hybridization protocol All Hybridisation and Wash procedures were performed following instructions in the Experienced User Card #2, Hybridize/Wash 8-sample BeadChip protocol (Illumina). Briefly, 34ul of the Hyb mix with labeled cRNA sample was dispensed onto the center of each array and allowed to hyb with rotations in a pre-heated oven for 16-20h at 55*C. Washes were done with Wash E1BC solution, Block E1 solution was used for blocking and detection performed by Block E1 solution+Streptavidin-Cy3/5.
Scan protocol standard Illumina procedures
Description 100nM Scrambled oligo transfection plus 100nM RA treatment, 48hr, replicate 1
Data processing RMA normalization
 
Submission date Apr 07, 2006
Last update date Mar 21, 2008
Contact name Bing Lim
E-mail(s) limb1@gis.a-star.edu.sg
Phone +65 64788156
Fax +65 64789005
URL http://www.gis.a-star.edu.sg
Organization name Genome Institute of Singapore
Department Stem Cell and Developmental Biology
Lab Stem Cell and Developmental Biology
Street address 60 Biopolis street, #02-01 Genome
City Singapore
State/province Singapore
ZIP/Postal code 138672
Country Singapore
 
Platform ID GPL4865
Series (1)
GSE4522 MicroRNA-134 Modulates Mouse Embryonic Stem Cell Differentiation

Data table header descriptions
ID_REF illumina ProbeID
VALUE illumina rank invariant normalized signal value
DET_VALUE illumina detection probability

Data table
ID_REF VALUE DET_VALUE
scl00227525.1_330-S 6.4 0.64053076
scl0003883.1_511-S 67 0.90952955
scl16326.12.4_133-S -23.7 0.30277443
scl00269955.1_25-S 13.4 0.68516285
scl0011717.2_283-S -35 0.18214717
scl52892.1.1_103-S -54.2 0.04221954
scl0012946.2_3-S 55.2 0.88178528
scl33480.16_131-S 60.4 0.8986731
scl0018762.1_190-S 251.7 0.99758745
scl00063.1_124-S -66 0.00844391
scl45217.22.1_37-S 216.9 0.99638118
scl056379.2_58-S -22.8 0.31363088
scl0268448.7_23-S 71.5 0.91797346
scl44375.15.1_26-S -43.1 0.11097708
scl0018933.1_65-S -40.8 0.1278649
scl0026384.1_20-S 508.4 1
scl29237.16.1_12-S 20.3 0.73220748
scl0074102.2_20-S -50.6 0.06031363
scl18491.1.2_327-S 52.4 0.87334138
scl16334.7.1_2-S 1311.1 1

Total number of rows: 24044

Table truncated, full table size 778 Kbytes.




Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap