 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 01, 2014 |
| Title |
NPRL3 HD3 rep 2 [4C-Seq] |
| Sample type |
SRA |
| |
|
| Source name |
erythroblast cell line
|
| Organism |
Gallus gallus |
| Characteristics |
cell line: HD3 erythroblast cell line
cell line details: clone A6 of the line LSCC
anchor(s): NPRL3
|
| Treatment protocol |
1×107 cells were fixed with 2% formaldehyde in DMEM medium supplemented with 10% fetal bovine serum (FBS) for 10 min at room temperature, and then the reaction was stopped by the addition of glycine to 0.125 M. After washing with PBS/10% FBS, the fixed cells were incubated for 10 min in an ice-cold lysis solution (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% Nonidet P40, and a protease inhibitor cocktail (Fermentas)) at a concentration of 2×107 cells/ml to release the nuclei. The nuclei were harvested and suspended in 0.5 ml of 1.2× restriction buffer 2 (New England Biolabs). SDS was added to a final concentration of 0.3%, and the solution was incubated for 1 h at 37°C with shaking. Triton X-100 was added to 1.8%, and the solution was further incubated for 1 h at 37°C to sequester the SDS. The DNA was digested by overnight incubation with 800 units of HindIII (New England Biolabs) at 37°C with shaking. The restriction endonuclease was inactivated by the addition of SDS to a final concentration of 1.6% and incubation for 20 min at 65°C. The solution was diluted by adding 7 ml of 1× ligation buffer (Fermentas). Triton X-100 was added to 1%, and the solution was incubated at 37°C for 1 h while shaking. Next, 100 U of T4 DNA Ligase (Fermentas) was added, and the DNA was ligated for 4.5 h at 16°C and then for 30 min at room temperature with slow agitation. Cross-links were reversed by incubation at 65°C for 16 h in the presence of Proteinase K (40 μg/ml). After cross-link reversion, RNase A was added to a final concentration of 40 μg/ml, and RNA was digested for 45 min at 37°C. The DNA was purified by extraction with phenol followed by precipitation with ethanol. To further purify DNA, the samples were processed with QIAEX II Gel Extraction Kit (Qiagen). The concentration of DNA was determined using a fluorometric assay (Qubit, Invitrogen). 50 µg of a ligated 3C DNA template was digested overnight at a concentration of 100 ng/µl with 200 units of DpnII (New England Biolabs). The restriction endonuclease was inactivated by incubation for 20 min at 65°C, and the DNA was purified by phenol-chloroform extraction and ethanol precipitation. Next, the DNA was ligated with 100 units of T4 DNA Ligase (Fermentas) in 14 ml of 1× ligation buffer (Fermentas) for 4 h at 16°C. Ligation products were precipitated with ethanol and further purified using QIAquick PCR purification kit (Qiagen). To linearize the circles of interest, the DNA was treated with a tertiary restriction enzyme of choice: EcoNI for TSR3 bait; NcoI for GENE-Des desert bait, TRAP1 bait and PPL bait; and EcoRV for NPRL3 bait. Digested products were purified using QIAquick PCR purification kit (Qiagen).
|
| Growth protocol |
The avian erythroblastosis virus-transformed chicken erythroblast cell line HD3 (clone A6 of the line LSCC (Beug, 1979;Beug, 1979) and the DT40 lymphoid cell line (CRL-2111, ATCC) were grown in Dulbecco’s Modified Eagle Medium supplemented with 2% chicken serum and 8% fetal bovine serum at 37ºC with 5% CO2. In the case of DT40 cells, the medium additionally contained 50 μM β-mercaptoethanol.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
PCR reactions were performed using the Expand Long Template PCR system (Roche). The 50 µl PCR reaction contained 120 ng of the DNA template, 1× PCR buffer 1, 0.3 µM of each of the primers, 0.35 mM of each of dNTPs, and 3.75 units of Hot start Taq DNA polymerase (SibEnzyme)Expand Long enzyme mix (Roche). The sequences of HindIII / DpnII 4C primers are as follows (5’-3’): TSR3 bait CACTCATCTCCCCGTACTTTG / AAGTTTCTTTTAATTTGGAGACTTTC; GENE-Des bait AATTTGTGAAGCAGTTGTATGTAGTC / TCTTCTCCACATAATCCCACACT; NPRL3 bait GCCAGGATATAGATTCTGCTTT / CCTCTGACATAATTGCCGATAG; TRAP1 bait CCAGAGATTCTCAAATCACAGCA / CTATGGGGACAAGTGAGGAACAG; PPL bait AAAGCATCTCCTCTCCCTGAAG / GTCTCCCACAGTCACTCCTCCT. PCR amplification was performed in the linear range as follows: initial denaturation for 2 min at 94°C; 30 cycles of 15 s at 94°C, 1 min at 57°C, and 3 min at 68°C; final elongation for 4 min at 68°C. PCR products were purified and concentrated using QIAquick PCR purification kit (Qiagen). After separation according to sizes in 1.5% agarose gel, two zones - 70-400 bp (S fraction) and 400-1500bp (L fraction) - were cut. After extraction with QIAquick gel extraction kit (Qiagen), the fragments of L-fraction were sonicated to reduce the fragment size to 100-500 nucleotides using Covaris S220 with following parameters: time 300 seconds, duty cycle 10%, peak power 23W. Then S and L fraction were processed using TruSeq DNA sample prep kit v.2 (Illumina) with post-PCR size selection on agarose gel (fragments with length 200-600 nucleotides were selected). After purification library concentrations were measured using Qubit fluorimeter (Invitrogen) and real-time PCR with primers complementary to distal regions of Illumina adapters (I-qPCR-1.1: AATGATACGGCGACCACCGAGAT and I-qPCR-2.1: CAAGCAGAAGACGGCATACGA). Then libraries from S and L fractions were combined in equal amounts, diluted to 2nM, denatured using 0.1M NaOH and diluted to final concentration 10 pM using HT1 buffer (Illumina).
Cluster generation was performed using cBot instrument and TruSeq PE Cluster Kit v3 reagents and sequencing - using HiSeq2000 instrument and TruSeq SBS Kit v3 reagents (Illumina) with read length 101 nucleotides from each end.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
HD3_NPRL3_rep2
|
| Data processing |
Library strategy: 4C-Seq
Basecalling with CASAVA 1.8.2 software
Merging the reads from L and S fractions where both fractions were sequenced (see library construction protocol)
Trimming read subsequences originating from the bait region. Leaving only one read from the pair, the subsequence after HindIII restriction site
Mapping to galGal4 genome with bowtie aligner
For every HindIII restriction fragment, summing up the number of reads mapped to the left and the right end of the fragment
Genome_build: Gallus_gallus-4.0
Supplementary_files_format_and_content: bedGraph files containing the number of 4C reads (score column) per HindIII restriction fragment
|
| |
|
| Submission date |
Oct 31, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Artem V Artemov |
| Organization name |
Medical University of Vienna
|
| Department |
Center for Brain Research
|
| Street address |
Spitalgasse 4
|
| City |
Vienna |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL16133 |
| Series (2) |
| GSE51937 |
Clustering of CpG islands constitutes an important determinant of the interphase chromosome 3D organization [4C-Seq] |
| GSE51939 |
Clustering of CpG islands constitutes an important determinant of the interphase chromosome 3D organization |
|
| Relations |
| BioSample |
SAMN02389606 |
| SRA |
SRX371988 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1255516_HD3_NPRL3_rep2.bedGraph.gz |
2.3 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
