NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1495680 Query DataSets for GSM1495680
Status Public on Sep 04, 2014
Title WT Sperm sRNA
Sample type SRA
 
Source name Sperm
Organism Arabidopsis thaliana
Characteristics genotype: wild type
tissue: sperm
cultivar: Columbia
Extracted molecule total RNA
Extraction protocol Small RNAs of 19-28nt were size selected by denaturing 15% PAGE, and cloned as previously described (Brennecke et al., 2007). Following ligation, small RNA libraries were reverse transcribed, PCR-amplified using the forward PCR primer (5’AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACG 3’) and the reverse PCR primer (5’ CAAGCAGAAGACGGCATACGATTGATGGTGCCT ACAG3’) for 22 cycles using proofreading Taq polymerase, and the products of 105 to 120bp were isolated.
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer
 
Data processing Adapter sequences were removed from raw sequence reads using crossmatch with a minimum match parameter of 5.
siRNA sequencing frequencies for 100 base windows along all five chromosomes were calculated by summation of the per-library sequencing frequencies of 21 and 24 nt siRNAs matching with 100% identity within the window by the number of times they matched the genome as a whole. Because the results of these calculations are on different scales, on the basis of the depth of each sequence library, a layer of per-library normalization based on the sum values of all small RNAs matching the genome was implemented.
Genome_build: TAIR8
Supplementary_files_format_and_content: UCSC wiggle format coverage files
 
Submission date Sep 03, 2014
Last update date May 15, 2019
Contact name Robert A Martienssen
E-mail(s) martiens@cshl.edu
Organization name Cold Spring Harbor Laboratory
Department Delbruck Bldg.
Lab Martienssen
Street address 1 Bungtown Rd
City Cold Spring Harbor
State/province NY
ZIP/Postal code 11724
Country USA
 
Platform ID GPL9062
Series (1)
GSE61028 Epigenetic reprogramming and small RNA silencing of transposable elements in pollen.
Relations
BioSample SAMN03016039
SRA SRX694621

Supplementary file Size Download File type/resource
GSM1495680_rmks03_2x21mers-100.wig.gz 180.9 Kb (ftp)(http) WIG
GSM1495680_rmks03_2x24mers-100.wig.gz 341.8 Kb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap
External link. Please review our privacy policy.