|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Sep 04, 2014 |
Title |
WT Sperm sRNA |
Sample type |
SRA |
|
|
Source name |
Sperm
|
Organism |
Arabidopsis thaliana |
Characteristics |
genotype: wild type tissue: sperm cultivar: Columbia
|
Extracted molecule |
total RNA |
Extraction protocol |
Small RNAs of 19-28nt were size selected by denaturing 15% PAGE, and cloned as previously described (Brennecke et al., 2007). Following ligation, small RNA libraries were reverse transcribed, PCR-amplified using the forward PCR primer (5’AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACG 3’) and the reverse PCR primer (5’ CAAGCAGAAGACGGCATACGATTGATGGTGCCT ACAG3’) for 22 cycles using proofreading Taq polymerase, and the products of 105 to 120bp were isolated.
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer |
|
|
Data processing |
Adapter sequences were removed from raw sequence reads using crossmatch with a minimum match parameter of 5. siRNA sequencing frequencies for 100 base windows along all five chromosomes were calculated by summation of the per-library sequencing frequencies of 21 and 24 nt siRNAs matching with 100% identity within the window by the number of times they matched the genome as a whole. Because the results of these calculations are on different scales, on the basis of the depth of each sequence library, a layer of per-library normalization based on the sum values of all small RNAs matching the genome was implemented. Genome_build: TAIR8 Supplementary_files_format_and_content: UCSC wiggle format coverage files
|
|
|
Submission date |
Sep 03, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Robert A Martienssen |
E-mail(s) |
martiens@cshl.edu
|
Organization name |
Cold Spring Harbor Laboratory
|
Department |
Delbruck Bldg.
|
Lab |
Martienssen
|
Street address |
1 Bungtown Rd
|
City |
Cold Spring Harbor |
State/province |
NY |
ZIP/Postal code |
11724 |
Country |
USA |
|
|
Platform ID |
GPL9062 |
Series (1) |
GSE61028 |
Epigenetic reprogramming and small RNA silencing of transposable elements in pollen. |
|
Relations |
BioSample |
SAMN03016039 |
SRA |
SRX694621 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1495680_rmks03_2x21mers-100.wig.gz |
180.9 Kb |
(ftp)(http) |
WIG |
GSM1495680_rmks03_2x24mers-100.wig.gz |
341.8 Kb |
(ftp)(http) |
WIG |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|