|
| Status |
Public on Nov 10, 2014 |
| Title |
C. elegans JGG1 nsun-5 mutant |
| Sample type |
SRA |
| |
|
| Source name |
whole young adult hermaphrodites
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
genotype: JGG1 (nsun-5 mutant)
h2o2 stress: none
barcode: ACGCTCGACA
|
| Treatment protocol |
S. cerevisiae: 0.4 mM H2O2 (only for stress conditions) and after 15 or 75 min, 125 µg/ml cycloheximide (Sigma) were added and the cells were incubated at the same temperature with shaking for further 15 min.
|
| Growth protocol |
S. cerevisiae: Wild-type and rcm1 knockout yeast were grown overnight in 3 mL SC medium at 28°C with shaking. On the next day, 100 ml SD were inoculated with the overnight culture to an OD600 of 0.003 and grown at 28°C with shaking until the OD600 reached 0.5 - 0.6. C. elegans: Worms were synchronized by bleaching and cultivated until day 3 of adulthood.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA isolated from yeast polysome or monosome fractions was purified using Trizol (Life Technologies), DNAse I (Thermo Scientific) digested for 1 h, phenol-chloroform extracted, isopropanol precipitated and dissolved in 20 µl water. For C. elegans ~200 whole young adult hermaphrodites were washed 3x in PBS and lysed directly in Trizol by 30 cycles of sonication (30 s on, 30 s off) in a Bioruptor (Diagenode).
The EZ RNA Methylation Kit (Zymo Research) was used for bisulfite treatment and purification of converted RNA according to the instructions provided by the manufacturer. 400 ng RNA were reverse-transcribed using Super Script III reverse transcriptase (Life Technologies) and gene-specific reverse primers (see below) for 50 min following the manufacturer’s instructions. 5 µl cDNA was subjected to the following touchdown-PCR program in a 25 µl reaction with KAPA2G Robust Polymerase and Buffer A (Kapa Biosystems): 95°C 3 min 95°C 30 s* 55-45°C 30s* *20 cycles, -0.5°C annealing per cycle 72°C 1 min* 95°C 30 s** 45°C 30 s** **35 cycles 72°C 1 min** 72°C 5 min PCR products were gel-purified using PCR- and Gel Extraction Kit (Favorgen) and eluded in 30 µl. 5 µl were subjected to a second round of PCR as above using barcoded primers and only 30 cycles in the second cycling step (**). Up to 24 barcoded samples were pooled to equal molarity and subjected to IonTorrent sequencing using a 314 Torrent Sequencing Chip Kit (Life Technologies). Primer sequences (without barcode): SC-25S-rRNA_bisulfite_sense: TGGTTAGAAAGTGATGTT SC-25S-rRNA_bisulfite_as: TCTCATTAATCCATTCA CE-28S-rRNA_bisulfite_sense: TGAATGTTAAATTGTAGTAATT CE-28S-rRNA_bisulfite_as: TCTCGTTAATCCATTCA For barcode sequences see "barcode" field in the SAMPLES section
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Ion Torrent PGM |
| |
|
| Data processing |
All reads were sorted by their bar codes and bar codes were subsequently removed (self-made Perl script).
Reads were aligned to the reference sequences using the Needleman-Wunsch algorithm. Before each alignment, the respective longer sequence (either the query- or the reference-sequence) was trimmed. Each sequence position was scored by following parameters: match = 10, cytosine to thymine conversion = 9, mismatch = 4, gap = 3, opening a new gap = 1
Aligned reads were filtered for sequences having less than 15% insertions or 15% deletions, or less than 20% insertions plus deletions. Sequences not fulfilling these requirements were removed (self-made Perl script).
In the remaining sequences the number of individual nucleotides was counted (self-made Perl script).
Genome_build: S. cerevisiae 25S rRNA [J01355.1] and C. elegans 28S rRNA [NR_000055.1]
Supplementary_files_format_and_content: base counts per sequence position as matrix
|
| |
|
| Submission date |
Nov 07, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Markus Schosserer |
| E-mail(s) |
markus.schosserer@meduniwien.ac.at
|
| Organization name |
Medical University of Vienna
|
| Department |
Center for Pathobiochemistry and Genetics
|
| Lab |
Markus Schosserer
|
| Street address |
Waehringer Strasse 10
|
| City |
Vienna |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL19396 |
| Series (1) |
| GSE63113 |
RNA bisulfite sequencing of 25S rRNA (C2278) in S. cerevisiae and of 28S rRNA (C3381) in C. elegans |
|
| Relations |
| BioSample |
SAMN03174014 |
| SRA |
SRX756765 |
