|
| Status |
Public on Mar 24, 2016 |
| Title |
rep4_smit_extended_totalRNA |
| Sample type |
SRA |
| |
|
| Source name |
cells in exponential growth (Galactose)
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: BY4741
genotype: MATa ade2 ade3 his3 leu2-3,112 trp1 URA3::Pgal1:pHZ18Split-MS2-GUAcGU
|
| Treatment protocol |
For nascent RNA extraction, 1l of cells was pelleted, washed with ice-cold PBS, quick-frozen in liquid nitrogen in 6 aliquots and kept at -80°C. For total RNA extraction, 50ml of exponentially growing cells were pelleted and used immediately for total RNA extraction.
|
| Growth protocol |
Cell cultures were grown in complete media (YPD) at 30°C and 250 rpm. For cell growth with Galactose as carbon source, cells were grown in YP containing 1% Raffinose and 2% D-Galactose. Cells were harvested in exponential growth at an OD (595nm) of 0.5-1.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nascent RNA was prepared using a nascent RNA isolation protocol for yeast (Carrillo Oesterreich et al. 2010) and Phenol:Chloroform:IAA, 25:24:1, pH 6.6 extraction. Total RNA was extracted with Phenol:Chloroform:IAA, 25:24:1, pH 6.6 using the RiboPure RNA Purification Kit, yeast (Life technologies).
Nascent RNA was 3’ end ligated to the DNA adaptor (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/) and reverse transcribed into cDNA with a primer complementary to the DNA adaptor (ATTGATGGTGCCTACAG). The cDNA solution was diluted by 1:2-1:5 and used as template for gene-specific PCRs. The forward primer was designed to bind to a gene-specific sequence, whereas the reverse primer targets the cDNA 3’ end with the adaptor sequence. Both primers carried Illumina library adaptor overhangs. The individual PCRs were pooled and PCR purified. The pooled cDNA was template for a second PCR, which attached final library adaptors.
All PCRs were adjusted in their cycle numbers. Prior to sequencing the double-stranded DNA ranging from ~150 bp (no insert product) to >2 kb was purified by gel electrophoresis. This step was not necessary for size-selected short RNA samples. Final sample purification was done with AMPure beads. Paired-end sequencing of DNA > 200 bp was done after Bioanalyser, Qubit and Kappa library quantification.
For 3' end sequencing, 3’ end ligated nascent RNA was heat-fragmented and then reverse transcribed using the DNA adaptor sequence as RT primer. The final paired-end sequencing library was prepared according to in-house protocols of the Yale Center for Genome Analysis.
targeted paired-end RNA-Seq
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Total RNA
R1 - 3-end read; R2 - SMIT read
processed data files: MS2_R1.bam, MS2_U4C_EEJ.bam, MS2_U4C_EEJ_final.length, MS2_U4C_EIJ.bam, MS2_U4C_EIJ_final.length
|
| Data processing |
Fastq files were filtered for read quality (fastq_quality_filter -Q 33 -q 20 -p 90).
The 3’ end read (R1) was filtered for 3’ end adaptor presence and Illumina sequencing primer with cutadapt (-g CATTGATGGTGCCTACAG -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGACCTCATCTCGTATGCCGTCTTCTGCTTG -n 2 -O 18 -m 23 -e 0.11 –match-read-wildcards –discard-untrimmed).
The SMIT read (R2) was filtered for the reverse-complement sequences with cutadapt (-a CTGTAGGCACCATCAATG -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -n 2 -m 28 -M <read length-21> -e 0.11 –match-read-wildcards).
PCR duplicates were removed with prinseq (prinseq-lite-0.20.4).
The 5 nt random 3’ barcode was removed with the FASTX toolkit (fastx_trimmer -Q 33 -f 6, version 0.0.13)
3’ end reads (R1) were mapped with tophat2 (2.0.13) to the S. cerevisiae genome (sacCer3) with the following settings: -p 5 -N 1 -m 0 –segment-mismatches 0 -i 30 -I 1010 -g 1 –segment-length 20 –no-coverage-search –library-type fr-firststrand –min-anchor-length 8 –min-coverage-intron 30 –max-coverage-intron 1010 –min-segment-intron 30 –max-segment-intron 1010.
The SMIT read (R2) was mapped with bowtie2 (2.2.5) to predefined junctions with the settings: -L 10 –end-to-end -N 0 -k 1 –norc.
For the 3' end sequencing data set, the 3' end linker was trimmed with cutadapt in forward and reverse read. Only reads containing the 3' end linker were kept and the 5 nt barcode was trimmed. Paired-end reads were mapped with tophat2.
Genome_build: sacCer3
Supplementary_files_format_and_content: 3'end (R1) and SMIT read (R2) mapped data (bam-format), text file containing insert length information (EEJ-spliced, EIJ-unspliced, IL-intronless)
|
| |
|
| Submission date |
Jul 14, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Lydia Herzel |
| E-mail(s) |
lydia.herzel@fu-berlin.de
|
| Organization name |
Freie Universität
|
| Department |
Biology, Chemistry and Pharmacy
|
| Lab |
Herzel
|
| Street address |
Takustr. 6
|
| City |
Berlin |
| ZIP/Postal code |
14195 |
| Country |
Germany |
| |
|
| Platform ID |
GPL13821 |
| Series (2) |
| GSE70907 |
Targeted paired-end sequencing of nascent RNA from S. cerevisiae |
| GSE70908 |
Splicing of nascent RNA coincides with intron exit from RNA polymerase II |
|
| Relations |
| BioSample |
SAMN03858456 |
| SRA |
SRX1097199 |
