 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 09, 2017 |
| Title |
BMA01-C14 |
| Sample type |
SRA |
| |
|
| Source name |
A single colony forming unit grown from human bone marrow aspirate donation
|
| Organism |
Homo sapiens |
| Characteristics |
donor number: 7
donorid: BMA01
donor age: 73
cell type: hematiopoietic progenitor
hmlh1 expression: 0
barcode: ACTAGGTCC
|
| Treatment protocol |
N/A
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA from individual CFU, CD34+, or RKO cells was harvested by Qiagen genomic DNA kit. DNA was next bisulfite modified and PCR amplified with forward oligonucleotides MLH1-AF (5' [Linker/spacer][barcode]actcaaaatcctctaccttataatatc 3'), MLH1-BF (5' [Linker/spacer][barcode]acaaaccaaacacaaaaccccat 3'), MLH1-CF (5' [Linker/spacer][barcode] tcacctcaacaaaaacacacaaac 3') when [linker/spacer]= (5' CGTATCGCCTCCCTCGCGCCATCAG 3') and [barcode] was sample specific. Negative oligonucleotides used were: MLH1-AR (5'[Linker/spacer][barcode]ttaaaagaagtaagatggaag 3'), MLH1-BR (5' [Linker/spacer][barcode]tttagttaataggagtagagatg 3'), MLH1-CR (5' [Linker/spacer][barcode]GTTAAATTTTTTAATTTTGTGGGTTGTTGGG 3') when [linker/spacer]= (5' CTATGCGCCTTGCCAGCCCGCTCAG 3') and [barcode] was sample specific.
Amplified products were run on an 1.5% agarose gel and appropriate sized bands excized. DNA fragments were purified from gel fragments and submitted for 454 sequencing. In parallel 1/2 of each sample was processed for RNA extracts. Total RNA was generated for each sample and used as the template for cDNA synthesis by a single cycle of reverse transcriptase activity followed by RNA digestion. Expression of the human gene hMLH1 (in parallel with human beta actin as a control) was next assessed for each cDNA sample generated by QRT-PCR on an Applied biosystems RT-PCR 7500 fast machine. Threshold values were automatically generated according to the manufacturers protocol. Gene expression for hMLH1 (scored as 1) was considered observed if amplification products broke threshold for both hMLH1 and beta actin. However, loss of hMLH1 (scored as 0) gene expression was defined as the observation of detectable amplification products for beta actin but not hMLH1
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
454 GS FLX |
| |
|
| Description |
bisulfite modified PCR amplified genomic DNA
|
| Data processing |
version 2.6 of gsRunProcessor
doValleyFilterTrimBack>true<
vfBadFlowThreshold>4<
vfLastFlowToTest>320<
vfMaxFailedPercent>100<
vfTrimBackMinimumLength>84<
vfTrimBackScaleFactor>0.7<
if test="Run.Flow.CycleCount > 299"><vfTrimBackScaleFactor>2.2</vfTrimBackScaleFactor>
vfScanLimit>4096</vfScanLimit
computeUopt>false</computeUopt><scaleMultimers>false</scaleMultimers>
doQScoreTrim>true<
errorQscoreWindowTrim>0.010</
QScoreTrimNukeWindowSize>40<
QScoreTrimBackScaleFactor>0.9<
if test="starts-with(InstrumentModel,'GSJUNIOR_A')"><QScoreTrimBackScaleFactor>1.2</
if test="Run.Flow.CycleCount > 299"><QScoreTrimBackScaleFactor>1.5</
enable>true</enable><options>--fna --qual --454BaseCallerMetrics.txt --454BaseCallerMetrics.csv --454RuntimeMetricsAll.txt --454RuntimeMetricsAll.csv --454QualityFilterMetrics.txt --454QualityFilterMetrics.csv --454AllControlMetrics.txt --454AllControlMetrics.csv
sequence reads were next screened by barcode and compared to a hypothetical bisulfite modified 100% unmethylated sequence. All sequences with less than 70% homology to the hypothetical sequence were discarded.
Each CpG within sequence reads was then scored 0 for unmethylated or 1 for methylated. Frequency of methylation at each CpG was next calculated for each sample.
Supplementary_files_format_and_content: .tab processed files are the sequence reads obtained for each barcode from the raw data and screened (70% cutoff) for homology to a theoretical 100% bisulfite (BS) converted sequence of the hMLH1 promoter PCR amplification products from the given primers in the spreadsheet. The first column contains the unique sequence read name (G6ZBNM301CO5B5 for instance) which was generated by the run and plate location. The second column are the sequence reads with the barcodes trimmed (this was done to facilitate the 70% homology screen).
Supplementary_files_format_and_content: .csv files contain the CpG methylation scoring and frequencies. Three regions of the hMLH1 gene were amplified and sequenced (fragments were named A, B, C). The first row is a header, subsequent rows contain sequence read specific data. The first column of these files is the sequence read name, followed by the read length, then several columns of scores (1 = methylated or 0 = unmethylated) for each CpG within the amplified product, the next column shows the aveidentity (% sequence homology to hypothetical BS converted), and the last column is the sequence of bases observed at the CpG sites for that sequence read (A;A;R;A.... etc. for instance indicates the third CpG site was methyated).
|
| |
|
| Submission date |
Oct 08, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Jonathan D Kenyon |
| Organization name |
Case Western Reserve University
|
| Department |
Pathology
|
| Lab |
2-104 WRB
|
| Street address |
2103 Cornell
|
| City |
Cleveland |
| State/province |
OH |
| ZIP/Postal code |
44106 |
| Country |
USA |
| |
|
| Platform ID |
GPL9186 |
| Series (1) |
| GSE73868 |
High throughput bisulfite sequencing of the MLH1 promoter in human hematiopoietic progenitor cell clones |
|
| Relations |
| BioSample |
SAMN04156968 |
| SRA |
SRX1318799 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1904627_ACTAGGTCC_A.csv.gz |
38.1 Kb |
(ftp)(http) |
CSV |
| GSM1904627_ACTAGGTCC_ABC.tab.gz |
132.0 Kb |
(ftp)(http) |
TAB |
| GSM1904627_ACTAGGTCC_B.csv.gz |
45.0 Kb |
(ftp)(http) |
CSV |
| GSM1904627_ACTAGGTCC_C.csv.gz |
422 b |
(ftp)(http) |
CSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
