|
| Status |
Public on Apr 20, 2017 |
| Title |
control_rep1 |
| Sample type |
RNA |
| |
|
| Source name |
late blastula embryos, control morpholino
|
| Organism |
Xenopus tropicalis |
| Characteristics |
tissue: embryos
developmental stage: late blastula
morpholino: control
replicate: 1
|
| Treatment protocol |
Radial injections were performed at the 2-4 cell stage with 30ng BRG1 morpholino (CCATTGGAGGGTCTGGGGTGGACAT) or 60ng control morpholino and cultivated until late blastula stage.
|
| Growth protocol |
Xenopus tropicalis eggs were collected, in vitro fertilized, microinjected and cultivated following standard procedures. Embryos were staged according to Nieuwkoop and Faber (1967).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA of 10 embryos was extracted using Trizol (Ambion) and phenol/chloroform. The RNA was precipitated with 70% isopropanol and cleaned using the RNeasy Cleanup Kit (Qiagen) including DNaseI-on-column digestion.
|
| Label |
biotin
|
| Label protocol |
Standard Affymetrix protocol.
|
| |
|
| Hybridization protocol |
Standard Affymetrix protocol.
|
| Scan protocol |
Standard Affymetrix protocol on GeneChip Scanner 3000.
|
| Description |
A1
|
| Data processing |
R/Bioconductor, rma normalization, default parameters.
|
| |
|
| Submission date |
May 27, 2016 |
| Last update date |
Apr 21, 2017 |
| Contact name |
Tobias Straub |
| E-mail(s) |
tstraub@med.uni-muenchen.de
|
| Organization name |
LMU Munich
|
| Department |
Biomedical Center, Bioinformatics
|
| Street address |
Großhadener Str. 9
|
| City |
Martinsried |
| ZIP/Postal code |
82152 |
| Country |
Germany |
| |
|
| Platform ID |
GPL10263 |
| Series (2) |
| GSE82017 |
BRG1 Chromatin Remodeling ATPase Balances Germ Layer Patterning by Amplifying the Transcriptional Burst at Midblastula Transition [BRG1] |
| GSE82019 |
BRG1 Chromatin Remodeling ATPase Balances Germ Layer Patterning by Amplifying the Transcriptional Burst at Midblastula Transition |
|
