GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2214245

Query DataSets for GSM2214245

Status

Public on Jan 17, 2017

Title

7_0_DAT_Rep_2_Light

Sample type

SRA

Source name

Leaf tissues

Organism

Triticum aestivum

Characteristics

stress: Light
sampling time: 0 day after treatment (DAT)
cultivar: Glenlea

Treatment protocol

At the boot stage, three sets of 24 plants each were exposed to one of three stress conditions for five consecutive days. The first set was exposed to continuous light. The second set was exposed to UV light for two min every day of the 5-day period. The third set, called heat-stressed, was transferred to a growth chambers where the temperature was kept constant at 37°C day and night. These plants were well watered twice per day during the 5-day stress exposure to avoid a confounding drought stress. The remaining 24 control plants were kept in the growth chamber at 16h/8h day/night at 18/16°C. After the 5-day stress exposure treatment, all plants were returned to the original growth chamber under control conditions. The experiment was conducted as a completely randomized block design with three biological replicates where each treatment and replicate corresponded to a group of eight plants.

Growth protocol

Wheat (Triticum aestivum L.) cv Glenlea plants, obtained from a single self-fertilized homozygous line, were grown in a PG-40 growth chamber under long-day conditions of 16h light at 18°C and 8h darkness at 16°C

Extracted molecule

total RNA

Extraction protocol

Leaf tissue was collected from individual plants at six time points: 0, 1, 2, 3, 7 and 10 DAT where 0 DAT corresponded to tissue sampled immediately at the end of the 5-day stress exposure period, prior to their return to the non-stressful growth conditions. Leaf tissue pieces, approximately 2.5 cm in length, were pooled from the eight plants that represented each treatment and replicate. The harvested leaf tissue pools were flash-frozen and stored in liquid nitrogen until RNA extraction. For the latter, tissue samples were ground to a fine powder with liquid nitrogen in a mortar and pestle. Total RNA was isolated from homogenized tissue samples using TRI-reagent as per manufacturer’s instructions (Ambion, Naugatuck, CT). Total RNA quality and quantity were assessed on an Agilent 2100 Bioanalyzer with the RNA 6000 Nano chip (Agilent Technologies, Santa Clara, CA). A total of 72 high-quality total RNA samples, corresponding to three biological replicates, four treatments and six sampling time points, were produced.
Small RNA libraries were constructed for each of the 72 samples from 5 µg of total RNA using a plate-based method developed at the BC Cancer Agency Genome Sciences Centre (Vancouver, BC, Canada). Briefly, total RNA samples were mixed with oligo-dT microbeads and loaded into a 96-well MACS column (Miltenyi Biotec, Germany). The sRNA fractions were recovered from the flow-through and precipitated with ethanol. Quality was assessed for a subset of 12 samples using an Agilent Bioanalyzer RNA 6000 Nano chip (Agilent Technologies). An adenylated 3’-adapter (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTGT /3ddC/3’) was ligated using a truncated T4 RNA ligase (New England BioLabs, Ipswich, MA) by incubating at 22°C for 1 hour. An RNA 5’-adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA-3’) was then added using a T4 RNA ligase (Ambion) by incubating at 37°C for 1h. The first strand cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) and RT primer (5'-CAAGCAGAAGACGGCATACGAGAT-3’). The cDNA was used as template for PCR amplification where unique index sequences were introduced to enable identification of the pooled libraries. PCR cycling conditions were 98°C for 30 sec, followed by 15 cycles at 98°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec and a final incubation at 72°C for 5 min. The quality of the libraries was assessed using a Caliper LabChipGX DNA chip (PerkinElmer, Waltham, MA). Three pools of randomly assigned sRNA libraries were created, resolved on a gel and, the 145-160 bp fractions were size-selected. Pooled libraries were ethanol precipitated and quality checked using an Agilent Bioanalyzer DNA1000 chip (Agilent Technologies). Each pooled library was diluted for cluster generation on a HiSeq 2000 flow cell according to manufacturer’s instructions. Small RNA sequencing was performed using a 50 cycle HiSeq SBS v4 kit

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina HiSeq 2000

Data processing

Adapter sequences were trimmed using a custom Perl script and quality assessment was performed using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
Reads ranging from 18 to 24 bp were filtered and exported as fasta files using Geneious (Biomatters Ltd, Auckland, New Zealand)
Redundant reads from each dataset were grouped as distinct tags and were used to query the Rfam (version 11) and wheat chloroplast (http://www.ncbi.nlm.nih.gov/nuccore/NC_002762.1) databases to remove rRNAs, tRNAs, snRNAs, snoRNAs, other long non-coding RNAs and chloroplast sequences
Distinct tags represented by ≥10 reads per million (RPM) in at least one library were mapped to miRNA coding loci previously identified from the hexaploid bread wheat assembly (International Wheat Genome Sequencing Consortium, Science 2014) using Bowtie2. These tag sequences were then matched to another set of high confidence precursor sequences (Kurtoglu et al. Funct Integr Genomics 2014). Distinct tags with 0 mismatch were extracted for hairpin structure prediction using RNAfold (Lorenz et al. Algorithms Mol Biol 2011).
The distinct tags with secondary hairpin structure with <-0.2 kcal/mol/nt were filtered for prediction of star sequence in the opposite strand with a 2bp offset on the 3’-strand of the hairpin.
The read counts of miRNAs annotated with strong evidence for biosynthesis were chossen for differential expression ananysis.
Genome_build: GCA_000818885.1 - International Wheat Genome Sequencing Consortium (IWGSC) Science 2014
Supplementary_files_format_and_content: Conserved miRNA families and their coresponding read counts.xls

Submission date

Jun 27, 2016

Last update date

May 15, 2019

Contact name

Sylvie Cloutier

E-mail(s)

sylviej.cloutier@canada.ca

Organization name

Agriculture and Agri-Food Canada

Street address

960 Carling Avenue