|
| Status |
Public on May 03, 2017 |
| Title |
deltaWapl-mut3_Dam-Only_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
HAP1 cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: HAP1
genotype: WaplKO_3.3
dam: Dam
replicate: 1
|
| Treatment protocol |
300.000 cells were plated per 6 well and transduced with virus encoding either Dam only or Lamin-Dam
|
| Growth protocol |
HAP1 cells (Carette et al., 2011) were cultured in IMDM (Invitrogen) supplemented with 10% FCS (Clontech), 1% Penicillin-Streptomycin (Invitrogen) and 1% Ultraglutamin (Lonza).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA isolation was performed using the Isolate II Genomic DNA isolation kit
DNA was digested for 4 hours at 37˚C by DpnI. Adapters were ligated overnight at 16˚C and products were amplified by PCR. DNA was isolated using a QIAquick PCR Purification kit and sheared using the Covaris S2 instrument. Library was prepared using a KAPA HTP Library preparation kit
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
WAPL KO Hap1 cell expressing soluble Dam
|
| Data processing |
Library strategy: DamID
All reads were processed by removing the adapter sequences: "GGTCGCGGCCGAG" or "CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAG" using cutadapt version 1.9.1
Reads were mapped against the reference human genome hg19 using bowtie2 with default parameters (except for --local and -k 3)
Reads that mapped in multiple locations were discarded
We calculated the coverage of reads per GATC fragment using the program htseq-count. GATC fragments were obtained by digesting in-vitro the reference genome with in-house scripts. We excluded un-mappable regions bigger than 5Kb
We concatenated GATC fragments in 50Kb windows (each window starting and finishing in a "GATC").
The DamID profiles were calculated as the log2 ratio of the coverage of reads in the 50Kb-extended GATC fragments between Lamin-Dam and Dam-only
Genome_build: hg19
Supplementary_files_format_and_content: *.GATCcounts.txt contains total read count per GATC: Format is as followed: "GATC ID": "Chr" : "Start Position" : "End Position" : "Total read count at the GATC"
|
| |
|
| Submission date |
Feb 28, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Robin H. van der Weide |
| Organization name |
Hubrecht Institute
|
| Lab |
Kind Lab
|
| Street address |
Uppsalalaan 8
|
| City |
Utrecht |
| State/province |
Utrecht |
| ZIP/Postal code |
3584 CT |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL11154 |
| Series (2) |
| GSE95015 |
The cohesin release factor WAPL restricts chromatin loop extension. |
| GSE95520 |
The cohesin release factor WAPL restricts chromatin loop extension [DamID] |
|
| Relations |
| BioSample |
SAMN06471288 |
| SRA |
SRX2599591 |
