GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2515854

Query DataSets for GSM2515854

Status

Public on Apr 01, 2017

Title

tSTATcc-463A_palindrome (bound)

Sample type

SRA

Source name

Synthesized DNA

Organism

synthetic construct

Characteristics

library: DNA oligos

Extracted molecule

other

Extraction protocol

All EMSA were done with STAT1 and mutants in 1X NEB Cutsmart buffer (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg/ml BSA, pH 7.9@25°C), supplemented with 10% glycerol with 1mM of dsDNA and were incubated for 30 minutes on ice. Electrophoresis mobility assay (EMSA) were done using native 12% PAGE prepared as Tris/Glycine (25mM Tris pH 8.3; 192mM glycine) mini-gels. These gels were first pre-run using 1X Tris/Glycine buffer (25mM Tris pH 8.3; 192mM glycine) at 200V for 30 minutes, then samples were loaded for an additional run of 60 minutes at 200 V at 4°C. After EMSA, the gels were stained with ethidium bromide and visualized using Biorad gel imager. Each band detected in the EMSA were excised and the DNA in the gel extracted by incubating for 30 mins at 50°C in 50ml acrylamide gel extraction buffer (500mM Ammonium acetate, 10mM Magnesium Acetate, 1mM EDTA, 0.1% SDS). Sample in the extraction buffer were purified with QIAquick Nucleotide Removal Kit (Qiagen) following the manufacturer’s instructions. Each fraction of DNA was barcoded and amplified using HotStart PCR Master Mix (Lambda Biotech). DNA was denatured at 94°C for 30 seconds, annealed at 55°C for 30 seconds and extend at 72°C for 45 seconds per round for 12 to 20 rounds with modified Indexed-Illumina primers.. The PCR product was then purified again using QIAquick Nucleotide Removal Kit.
DNA libraries for EMSA were constructed by either using GAATAGTCTCATTAACACCGGTTCNNNGAAAGATCATCAAGAGCACACGGG and GAATAGTCTCATTAACACCGGNNNCCGGAAAGATCATCAAGAGCACACGGG (for STAT1 and STAT1N460H mutant) separately or mixing them (Other STAT1 mutants such as K336A, S459A, S459R, N460A, N460R, Q463A, Q463R). The effect of CpG methylation was studied by mixing libraries, GACTAGTCTCATTAACACCAGTTCNNNGAAAGATCATCAAGAGCAGACTGG and GACTAGTCTCATTAAGACCAGTTCNNNGAAAGATCATCAAGAGCAGACTGG or GACTAGTCTCATTAACACCAG NNNCCGGAAAGATCATCAAGAGCAGACTGG and GACTAGTCTCATTAAGACCAGNNNCCGGAAAGATCATCAAGAGCAGACTGG. A single nucleotide internal barcode (higlighted and underlined) was used to distinguish the libreries in mixture. To make double-stranded DNA (dsDNA) libraries, 100 pmole single-strand degenerate template sequences were mixed with an equal amount of primer reverse complementary to the 3' flanking region of the binding site (highlighted). In the presence of Taq Polymerase, a brief 10-sec denaturing followed by 10 min of 55 degree annealing/extension is sufficient to make dsDNA libraries. The reaction mixtres were digested by 1 ml NEB Exo I exo- nuclease (New England Biolabs, Beverly, MA) for 30 min to eliminate unextended single-stranded DNAs (ssDNA). All final dsDNA products were purified by QIAGEN (Valencia, CA) PCR purification columns.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

Illumina MiSeq

Description

Contains bound and unbound reads needed to calculate relative binding energies.
tSTATcc-463A_palindrome.txt

Data processing

Extracting binding sites sequence from raw reads.
Count read numbers for each variant, classified by bound or unbound in specseq.
The bound/unbound ratio for each variant and the negative logarithm of the retios were caculated.
Each processed file summarizes all these values in five columns. The first column represents a specific sequence in the library. Columns two to five represent numbers of bound reads, numbers of unbound reads, the bound/unbound ratios and the negative logarithms of the ratios, respectively.
Genome_build: N/A
Supplementary_files_format_and_content: Tab delimited text files.

Submission date

Feb 28, 2017

Last update date

May 15, 2019

Contact name

Basab Roy

E-mail(s)

broy4@asu.edu

Phone

4803818022

Organization name

Washington University School of Medicine