|
Status |
Public on Mar 20, 2018 |
Title |
E_plus:TGGATAGCGTC |
Sample type |
SRA |
|
|
Source name |
BL-CFC day3 of culture (differentiated murine embryonic stem cells)
|
Organism |
Mus musculus |
Characteristics |
wellbarcode: TGGATAGCGTC sampletype: E_plus chiprowid: 65 chipcolumnid: 42
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Wafergen iCELL8 standard protocol Nextera XT DNA (Illumina), sc-RNA Seq (single cell RNA Seq)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
A2lox.Empty with doxycycline
|
Data processing |
demultiplexing of reads using well barcode in read1 (read1 contains well barcode 11bp directly followed by 10bp molecule barcode (UMI) followed by 9bp of fragment; read2 contains transcript sequence part of fragment). Demultiplexed files (one per barcode) contain read2 and the UMI extracted from read1 has been added to the read name. trimming of read2 with cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -a GGGGGGGGGGGGGGGGGGGGG -a AAAAAAAAAAAAAAAAAAAAA -a GCGTCGTGTAGGGAA -g TTCCCTACACGACGC -n 2 -m 15 --trim-n -q 25 -f fastq mapping with STAR --runMode alignReads --outFilterMismatchNoverLmax 0.1 --outSAMtype BAM SortedByCoordinate read counting with featureCounts -R -d 15 -s 1 -g gene_id -t exon -a Mus_musculus.GRCm38.79.gtf UMI counting (UMI barcode correction and filtering) Genome_build: Mus_musculus.GRCm38 Supplementary_files_format_and_content: The file countMatrix.txt contains a matrix of UMI counts (rows: gene identifiers as in Mus_musculus.GRCm38.79.gtf and columns: well barcodes as sample names).
|
|
|
Submission date |
Mar 23, 2017 |
Last update date |
May 15, 2019 |
Contact name |
Christophe Lancrin |
E-mail(s) |
christophe.lancrin@embl.it
|
Organization name |
EMBL
|
Department |
EMBL Rome
|
Street address |
Via Ramarini 32
|
City |
Monterotondo |
State/province |
RM |
ZIP/Postal code |
00015 |
Country |
Italy |
|
|
Platform ID |
GPL19057 |
Series (2) |
GSE96982 |
Single-cell RNAseq analysis of the empty and i8TF cell lines after 3 days of BL-CFC culture |
GSE96986 |
Single cell transcriptomics reveals new insights on the dynamical function of transcription factors during blood stem and progenitor cell formation |
|
Relations |
BioSample |
SAMN06639862 |
SRA |
SRX2670188 |