 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 21, 2008 |
| Title |
ddc_smRNA-seq |
| Sample type |
SRA |
| |
|
| Source name |
Immature floral tissue
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
drm1-2 drm2-2 cmt3-11, unopened flower buds
|
| Treatment protocol |
Immature (unopened) flower buds were collected and frozen in liquid nitrogen.
|
| Growth protocol |
All plants were grown in potting soil (Metro Mix 250; Grace-Sierra, Boca Raton, FL) at 23C under a 16-hour light/8-hour dark cycle.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
smRNA-seq library construction protocol:
Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Immediately following RNA precipitation, the flow through from the anion-exchange chromatography column was further precipitated in another 2.5 volumes of 100% ethanol (smRNA fraction). The smRNA fraction was further purified by a phenol-chloroform extraction and an additional ethanol precipitation. Small RNAs were resolved by electrophoresis of 2.5 mg of the smRNA fraction and 7.5 mg of total RNA on 15% polyacrylamide gels containing 7 M urea in TBE buffer (45 mM Tris-borate, pH 8.0, and 1.0 mM EDTA). A gel slice containing RNAs of 15 to 35 nucleotides (based on the 10 base pair ladder size standard (Invitrogen, Carlsbad, CA)) was excised and eluted in 0.3 M NaCl rotating at room temperature for 4 hours. The eluted RNAs were precipitated using ethanol and resuspended in diethyl pyrocarbonatetreated deionized water. Gel-purified smRNA molecules were ligated sequentially to 5' and 3' RNA oligonucleotideadapters using T4 RNA ligase (10 units/mL) (Promega, Madison, WI). The 5' RNA adapter (5' - GUUCAGAGUUCUACAGUCCGACGAUC - 3') possessed 5' and 3' hydroxyl groups. The 3' RNA adapter (5'-pUCGUAUGCCGUCUUCUGCUUGidT-3') possessed a 5' mono-phosphate and a 3' inverted deoxythymidine (idT). The smRNAs were first ligated to the 5' RNA adapter. The ligation products were gel eluted and ligated to the 3' RNA adapter as described above. The final ligation products were then used as templates in a reverse transcription (RT) reaction using the RT-primer (5' - CAAGCAGAAGACGGCATACGA - 3') and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). This was followed by a limited (15 cycle) PCR amplification step using the PCR reverse (5'-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3') and forward (5'-CAAGCAGAAGACGGCATACGA-3') primers and Phusion hot-start high fidelity DNA polymerase (New England Biolabs, Cambridge, MA). All oligonucleotides were provided by Illumina (Illumina, San Diego, CA). The amplification products were separated by electrophoresis on a 6% polyacrylamide gel in TBE buffer, eluted in 0.3 M NaCl rotating at room temperature for 4 hours, precipitated using ethanol, and resuspended in nuclease-free water
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
Sequence information was extracted from the image files with the Illumina Firecrest and Bustard applications and mapped to the Arabidopsis (Col-0) reference genome sequence (TAIR 7) with the Illumina ELAND algorithm. ELAND aligns 32 bases or shorter reads, allowing up to two mismatches to the reference sequence. For reads longer than 32 bases, only the first 32 bases will be used for alignment, while the remaining sequence will be appended regardless of similarity to the reference sequence. A Perl script was used to truncate the appended sequence at the point where the next four bases contain two or more errors relative to the reference sequence.
|
| Data processing |
Prior to alignment of the smRNA reads, a custom Perl script was used to identify the first seven bases of the 3? adapter sequence, and the read was truncated up to the junction with the adaptor sequence. Each of the reads was then mapped to the genome with BLAST using a word size of 10 and expectation value of 10. Only perfect matches were accepted, as these shorter reads will have a higher tendency to falsely map than longer reads. No further analysis was performed on reads that do not contain the adapter sequence, as their size class could not be determined precisely.
|
| |
|
| Submission date |
Mar 26, 2008 |
| Last update date |
May 15, 2019 |
| Contact name |
Joseph R Ecker |
| E-mail(s) |
ecker@salk.edu
|
| Phone |
8584534100
|
| Organization name |
HHMI-Salk-Institute
|
| Department |
Genomic Analysis Laboratory
|
| Lab |
Ecker lab
|
| Street address |
10010 North Torrey Pines Road
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92037 |
| Country |
USA |
| |
|
| Platform ID |
GPL9062 |
| Series (2) |
| GSE10877 |
Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| GSE10967 |
Highly integrated epigenome maps in Arabidopsis - small RNA sequencing |
|
| Relations |
| SRA |
SRX002509 |
| BioSample |
SAMN02195403 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM277610.txt.gz |
20.7 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data not provided for this record |
| Raw data are available in SRA |
|
|
|
|
 |
