 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 15, 2008 |
| Title |
Col-0-floral-GMUCT-seq-rep1 |
| Sample type |
SRA |
| |
|
| Source name |
immature floral tissue
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
Col-0, unopened flower buds
|
| Treatment protocol |
Immature (unopened) flower buds were collected and frozen in liquid nitrogen.
|
| Growth protocol |
All plants were grown in potting soil (Metro Mix 250; Grace-Sierra, Boca Raton, FL) at 23C under a 16-hour light/8-hour dark cycle.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA from wild-type Col-0 immature flower buds was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and treated with RNase-free DNaseI (Qiagen) for 25 min at room temperature. Following an ethanol precipitation, poly(A)+ RNA was column purified from 50 micrograms of the total RNA samples using Oligotex mRNA kit (Qiagen). The poly(A)+ RNA was then depleted for18S and 28S rRNA molecules in two sequential Ribominus (Invitrogen, Carlsbad, CA) reactions as per manufacturer's instructions, using 6 plant-specific biotinylated LNA oligonucleotide rRNA probes supplied by the manufacturer (Invitrogen, Carlsbad, CA). The rRNA-depleted poly(A)+ RNA was then ligated to the Illumina 5' smRNA adapter using T4 RNA ligase (10 units/mL) (Promega, Madison, WI). The 5' RNA adapter (5' - GUUCAGAGUUCUACAGUCCGACGAUC - 3') possessed 5' and 3' hydroxyl groups. The ligated rRNA-depleted poly(A)+ RNA was purified by phenol:chloroform extraction and ethanol precipitation. Oligo(dT) was then used to prime cDNA synthesis using SuperScript II reverse transcriptase(200 units/mL) (Invitrogen, Carlsbad, CA). The cDNA was then subjected to second strand synthesis using Oligo(dT) and the PCR primer specific for the Illumina 5' smRNA adapter (5' -AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA - 3'). The dscDNA was ethanol precipiated, and then fragmented by sonication to 50-500 bp with a Bioruptor (Diagenode Sparta, NJ), followed by end repair and ligation of the genomic DNA (gDNA) adapters provided by Illumina (Illumina, San Diego, CA) as per manufacturer's instructions for gDNA library construction. 100-200 ng of adapter-ligated dscDNA of 195-235 bp was isolated by agarose gel electrophoresis, and subsequently purified using a gel extraction kit (Qiagen, Valencia, CA). This was followed by a limited (16 cycle) PCR amplification step using the PCR primer specific for the Illumina 5' smRNA adapter (5' -AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA - 3') and primer 2.1 that is specific for the gDNA 3' adapter using Phusion hot-start high fidelity DNA polymerase (New England Biolabs, Cambridge, MA). Using this primer combination for the limited amplification enriched for the desired products that had an Illumina 5' smRNA adapted on the 5' end and the 3' gDNA adapter on the 3' end. The enriched library was purified with the PCR purification kit (Qiagen, Valencia, CA) and quantity and quality examined by spectrophotometry, gel electrophoresis, and limited sequencing of cloned library molecules.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
5'-RACE high-throughput sequencing
|
| Data processing |
Sequence information was extracted from the image files with the Illumina Firecrest and Bustard applications and mapped to the Arabidopsis (Col-0) reference genome sequence (TAIR 7) with the Illumina ELAND algorithm. ELAND aligns 32 bases or shorter reads, allowing up to two mismatches to the reference sequence. For reads longer than 32 bases, only the first 32 bases will be used for alignment, while the remaining sequence will be appended regardless of similarity to the reference sequence.
In order to avoid omitting unannotated transcripts, 36 nucleotide GMUCT reads were aligned to the Arabidopsis reference genome sequence (TAIR 7) with the ELAND algorithm.
|
| |
|
| Submission date |
Apr 25, 2008 |
| Last update date |
May 15, 2019 |
| Contact name |
Joseph R Ecker |
| E-mail(s) |
ecker@salk.edu
|
| Phone |
8584534100
|
| Organization name |
HHMI-Salk-Institute
|
| Department |
Genomic Analysis Laboratory
|
| Lab |
Ecker lab
|
| Street address |
10010 North Torrey Pines Road
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92037 |
| Country |
USA |
| |
|
| Platform ID |
GPL9062 |
| Series (1) |
| GSE11070 |
A link between RNA metabolism and silencing affecting Arabidopsis development |
|
| Relations |
| SRA |
SRX003076 |
| BioSample |
SAMN02195373 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM284751.txt.gz |
23.1 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data not provided for this record |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
