|
Status |
Public on Jun 14, 2018 |
Title |
VM CD8+ cells timestamped at day 1, moved to congenic recipients at 4 wks, collected 5 dpi (Listeria), rep 2 |
Sample type |
SRA |
|
|
Source name |
CD4-CD8+CD44hi TdTomato+ sorted cells
|
Organism |
Mus musculus |
Characteristics |
strain/background: C57BL/6 transgenic insertions: gBT-I, Ai9, CD4cre-ERT2 timestamp age: 1 day age at congenic transfer: 4 weeks collection time post-infection: 5 days tissue: spleen cell type: CD4-CD8+CD44hi TdTomato+
|
Treatment protocol |
To mark cell with TdTomato at specific times during development, mice were given tamoxifen at 1 day (through lactation, by administering tamoxifen orally to the Dam) or at 28 days of age (by direct oral administration to the mouse). The mice were then allowed to age such that both populations had the same amount of post-thymic maturation (4 wks). Adoptive transfers of stamped, CD44+ CD8+ T cells were performed to transfer equivalent numbers of antigen-specific CD8+ T cells in to congenically marked recipients. These recipients were infected with Listeria bearing the antigen the timestamped CD8+ T cells respond to (gB). 5 days later, timestamped cells were recovered for sequencing.
|
Growth protocol |
CD4cre-ERT2 mice were crossed to Ai9 mice bearing a floxed-stop TdTomato (RFP) element such that when F1 offspring are exposed to tamoxifen, all cells bearing CD4 will begin expressing TdTomato for the duration of tamoxifen exposure.
|
Extracted molecule |
total RNA |
Extraction protocol |
CD8+ cells were magnetically enriched with CD8 microbeads and sorted to > 95% purity with a FACS Aria III on CD4- CD8+TdTomato+. Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. Directional RNA-seq libraries were prepared from 25 ng total RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
TgVirtualMemory5dpi_1dayTimestampB Virtual memory CD8 cells timestamped at day 1, transferred to congenic recipients at 4 wks who were infected with Listeria and timestamped CD8+ T cells collected 5 days post-infection, rep 2. gene_exp.diff: 1dMP5 genes.read_group_tracking.txt: 1dMP5_1
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC). cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC). cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC). Genome_build: mm10 (UCSC) Supplementary_files_format_and_content: Tab-delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates, as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
|
|
Submission date |
Jan 28, 2018 |
Last update date |
Jun 14, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL19057 |
Series (2) |
GSE97802 |
The fate of CD8+ T cells during infection is linked to their developmental origin |
GSE109754 |
The fate of CD8+ T cells during infection is linked to their developmental origin [Virtual_Memory_following_infection_timestamp] |
|
Relations |
BioSample |
SAMN08426453 |
SRA |
SRX3605738 |