|
Status |
Public on Apr 10, 2018 |
Title |
241: 4X choline male rep 2 (mRNA) |
Sample type |
SRA |
|
|
Source name |
Mouse placenta
|
Organism |
Mus musculus |
Characteristics |
strain: non-Swiss Albino (NSA) tissue: Placenta developmental stage: Gestational day 15.5 fetal sex: Male diet treatment: 4X choline
|
Treatment protocol |
Prior to euthanization and tissue harvesting, the mice in this study were fed the AIN-93G diet, with either 1X choline concentration (1.4g choline chloride/kg diet; Dyets Cat #103345) or 4X choline concentration (5.6g choline chloride/kg diet; Dyets Cat #103347).
|
Growth protocol |
Prior to euthanization and tissue harvesting, the mice in this study had ad libitum access to the diet and water, and were housed in microisolator cages in an environmentally-controlled room (22-25°C, 70% humidity) with a 12-hour light-dark cycle.
|
Extracted molecule |
total RNA |
Extraction protocol |
Placenta tissues were removed from the mice after they were sacrificed at gestational day 15.5 and were immediately flash frozen in liquid nitrogen. RNA were extracted from the tissues using Trizol following the manufacturer's protocol. RNA-seq libraries were prepared from 1 ug total RNA using the NEBNext Directional Ultra RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
allSamples_gene_exp.diff: CH_3 allSamples_genes.read_group_tracking: CH_3 male_gene_exp.diff: CHM_1 male_genes.read_group_tracking: CHM_1
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.0 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC). cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC). cuffdiff v2.2 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC). Genome_build: Mouse mm10 (UCSC) Supplementary_files_format_and_content: Tab delimited cuffdiff2 output text files including individual sample results (raw counts, FPKM values in read_groups_tracking files) and differential gene expression results (log2FC, p-values, and q-values [corrected for multiple hypothesis testing] in gene_exp.diff files)
|
|
|
Submission date |
Mar 01, 2018 |
Last update date |
Apr 10, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL19057 |
Series (2) |
GSE111294 |
An exploratory study to examine the effects of maternal choline supplementation during mouse pregnancy on placental epigenetic markers (mRNA-seq data set) |
GSE111296 |
An exploratory study to examine the effects of maternal choline supplementation during mouse pregnancy on placental epigenetic markers |
|
Relations |
BioSample |
SAMN08627250 |
SRA |
SRX3753519 |