|
| Status |
Public on Aug 24, 2018 |
| Title |
H4.V ChIP_2 |
| Sample type |
SRA |
| |
|
| Source name |
whole liquid cell culture
|
| Organism |
Trypanosoma brucei brucei |
| Characteristics |
strain: Lister 427 MITat 1.2
genotype: TetR, T7RNAP, H4.V-/-, Ty1-H4.V (EC)
life cycle stage: Bloodstream form
chip antibody: BB2
|
| Treatment protocol |
H4.V ectopic expression induced by addition of doxycycline.
|
| Growth protocol |
All replicates were grown in HMI-11 (37 °C, 5% CO2) and drug selection was applied where necessary.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
200 million cells were harvested by centrifugation and fixed in the presence of 1% formaldehyde. Cells were washed and permeabilized with digitonin and chromatin was digested using MNase. Mononucleosomes were collected from the supernatant and residual mononucleosomes were extracted from the cell pellet by sonication. An input sample was seperated from the chromatin and stored at -20 °C. The IP was performed by addition of Ig-coated magnetic beads (BB2 Antibody against the Ty1-tag) and incubation over night at 4°C. The DNA was subsequently washed and eluted from the beads. Crosslinks were reversed in both the ChIP and input sample. The samples were purified and the concentration was determined using Qubit.
ChIP and input samples were end-repaired using T4 DNA polymerase (NEB),
Klenow large Fragment (NEB) and T4 DNA Polynucleotide Kinase (NEB). Protruding A-bases were added to the 3` end using Klenow fragment (3´ to 5´ exo minus) and dATP. TruSeq adapters were ligated to the cDNA fragments using Quick Ligase (NEB) and was purified using AMPure XP magnetic beads. Y-shaped adapters were converted to dsDNA with Illumina primers for 5 cycles, purified with magnetic beads and library fragments of 200-500 bp were size selected from an agarose gel. The gel-purified library was further amplified for 10-17 cycles using Illumina primers and purified using magnetic beads. Libaries were quantified using Qubit and qPCR and were sequenced on an Illumina flow cell in an Illumina NextSeq aparatus following the manufacturer's instructions
|
| |
|
| Library strategy |
MNase-Seq |
| Library source |
genomic |
| Library selection |
MNase |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
MNase ChIP
ws1ss1_ratio_L1800157_H4_V_Ty_MNase_Input_2_to_HGAP3_Tb427v9_bwa.sorted.mapq10_vs_L1800156_H4_V_Ty_MNase_ChIP_2_to_HGAP3_Tb427v9_bwa.sorted.mapq10.wig
ws2001ss501_ratio_L1800157_H4_V_Ty_MNase_Input_2_to_HGAP3_Tb427v9_bwa.sorted.mapq10_vs_L1800156_H4_V_Ty_MNase_ChIP_2_to_HGAP3_Tb427v9_bwa.sorted.mapq10.wig
ws501ss101_ratio_L1800157_H4_V_Ty_MNase_Input_2_to_HGAP3_Tb427v9_bwa.sorted.mapq10_vs_L1800156_H4_V_Ty_MNase_ChIP_2_to_HGAP3_Tb427v9_bwa.sorted.mapq10.wig
|
| Data processing |
Demultiplexing: bcl2fastq v.20.0.422
Read trimming: cutadapt v.1.15 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read alignment: BWA-mem v.0.7.16 -t 20
Read filtering: samtools v.1.8 view -hSb, sort, view -bh -@4 -q10
COVERNANT v0.3.2
Genome_build: Tb427v9
Supplementary_files_format_and_content: wiggle files
|
| |
|
| Submission date |
Aug 22, 2018 |
| Last update date |
Aug 24, 2018 |
| Contact name |
Konrad U. Förstner |
| E-mail(s) |
foerstner@zbmed.de
|
| Organization name |
ZB MED - Information Centre for Life Sciences
|
| Department |
Information Services
|
| Lab |
Förstner Lab
|
| Street address |
Gleueler Str. 60
|
| City |
Cologne |
| State/province |
North Rhine-Westphalia |
| ZIP/Postal code |
50931 |
| Country |
Germany |
| |
|
| Platform ID |
GPL22141 |
| Series (2) |
| GSE100896 |
H3.V and H4.V |
| GSE118938 |
Maps of histone variant H4.V deposition in Trypanosoma brucei brucei |
|
| Relations |
| BioSample |
SAMN09882517 |
| SRA |
SRX4597533 |
