GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3358233

Query DataSets for GSM3358233

Status

Public on Oct 01, 2019

Title

eaf3_5cap_rep1

Sample type

SRA

Source name

yeast cells

Organism

Saccharomyces cerevisiae

Characteristics

genotype: eaf3[delta]::KanMX
parental strain: BY4741(MATa his3[delta]1 leu2[delta]0 met15[delta]0 ura3[delta]0)
transcription factor: eaf3

Treatment protocol

No treatment for 5'cap-sequencing samples. For polyribosome analysis 100 mL of S. cerevisiae cells at OD600 ~1 were treated with cycloheximide for 5 minutes (100 µg/mL, final concentration), harvested by centrifugation and transferred to ice. Pellets were washed with ice-cold lysis buffer and resuspended in 700µL lysis buffer. Lysis buffer contains 20 mM Tris-HCl, pH 8, 140 mM KCl, 5 mM MgCl2 , 0.5 mM DTT, 1% Triton X-100, 100 µg/mL cycloheximide, 500 µg/mL heparin and complete EDTA-free protease inhibitor (1 tablet per 10 mL, Sigma Aldrich).

Growth protocol

Cells were grown in YPD (1% yeast extract, 2% peptone, 2% glucose and 40 mg/L adenine) and harvested at OD600 ~1.

Extracted molecule

total RNA

Extraction protocol

For 5'cap-sequencing samples RNA was extracted from yeast cells using standar phenol procedure using glass beads and a FastPrep-24 shaker. The amount of RNA was quantified in a Nanodrop 2000 Spectrophotometer (Thermo Scientific) and RNA integrity was checked by agarose gel electrophoresis. For polyribosome analysis, cells resuspended on Lysis buffer were transferred to pre-cooled 1.5mL screw-tubes with 300 µL glass beads and supplemented with 100 units of RNAse inhibitor (RNAsin plus, Promega). Cells were lysed using a FastPrep-24 shaker (6.0m/s for 15 seconds, MP biomedicals). Supernatant was recovered after 5 minutes centrifugation at 2300g, and cleared with an additional centrifugation at 5900g. Extracts were supplemented with glycerol (5% final v/v) and stored at -70C. 10-50% sucrose gradients were prepared with a Gradient Master BIOCOMP (Nycomed Pharma). Sucrose solution contains 20 mM Tris-HCl, pH 8, 140 mM KCl, 5 mM MgCl2 , 0.5 mM DTT, 100 µg/mL cycloheximide and sucrose (from 10 to 50 %). Cleared cell extracts were ultracentifuged at 34400 rpm for 2 hours 40 minutes at 4C using a C-1000 XP centrifuge with SW40 rotor (Beckman Coulter). Gradient UV absorption at 254 nm was measured and selected fractions were selected for 5’cap library preparation (5µg purified RNA per sample). Polyribosome fraction (i.e., 2n+) was compared with the total extract prior to fractionation).
5’cap-libraries was performed as previously described (Pelechano et al. Nat Protocols. 2016 PMID: 26820793). In brief, 10µg total RNA was treated with Calf intestinal alkaline phosphatase (NEB)to remove 5′P from fragmented and non-capped molecules. After purification, mRNA caps were removed using 3.75 units of Cap-Clip (Biozyme) exposing a 5’P in those molecules previously capped. Samples were ligated overnight at 16ºC with a DNA/RNA oligo (rP5_RND: TTTCCCTACACGACGCTCTTCCGATrCrUrNrNrNrNrNrNrNrN ) using T4 RNA ligase 1 (New England Biolabs). RNA integrity after ligation was assayed by agarose gel electrophoresis and polyA RNA was purified using oligo dT magnetic beads. After this, ligated mRNA was fragmented at 80ºC for 5 min in the presence of RNA fragmentation buffer (40 mM Tris-acetate, pH 8.1, 100 mM KOAc, 30 mM MgOAc). Ligated RNA was subjected to reverse transcription using random hexamers with Superscript II (Life Technologies) with the following program: 10 min at 25ºC, 50 min at 42ºC and heat inactivated for 15 min at 72ºC. Second strand cDNA synthesis was performed by a single PCR cycle (1 min at 98ºC; 2 min at 50ºC and 15 min at 72ºC) using Phusion High-Fidelity PCR Master Mix (New England Biolabs). A biotinilated oligo (BioNotI-P5-PET: [Btn]TATAGCGGCCGCAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT) was added during the generation of the second cDNA strand. Double stranded cDNA was purified using Ampure XP (Beckman Coulter) or HighPrep (Magbio) beads. After the samples were bound to streptavidin coated magnetic beads (M-280 Dynabeads, Life Technologies) and subjected to standard Illumina end-repair, dA addition and adapter ligation was performed as previously described. Libraries were enriched by PCR and sequenced in an Illumina HiSeq 2000 instrument.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina HiSeq 2000

Description

eaf3.normalized.plus.bedGraph
eaf3.normalized.minus.bedGraph

Data processing

Library strategy: 5'cap-seq
For 5’ cap sequencing reads, random barcodes were first extracted and added to the reads name. The reads were aligned to yeast genome with Novoalign (http://www.novocraft.com) using default setting.
After read alignment, a customized script adapted from UMI-tools was used for removing PCR duplicates. Specifically we allowed 1 bp shifting at the beginning of 5’ ends. CAGEr was employed for clustering the 5’ cap TSSs of BY4741 wild-type strain and the mutants. TSS counts in different samples were normalized to match a common reference power-law distribution. Data provided as normalized BedGraph. For polyribosome analysis reads PCR duplicateswere removed and assigned to CAGEr clusters. Data provided as UMI collapsed BedGraph.
Genome_build: S. cerevisiae R64-1-1
Supplementary_files_format_and_content: Bedgraph files for CAGE normalized reads for 5'cap- sequencing (independent filed for positive and negative strand), or UMI collapsed reads for polyribosome analysis (positive and negative strands in one file).

Submission date

Aug 28, 2018

Last update date

Oct 01, 2019

Contact name

Vicent Pelechano

E-mail(s)

vicente.pelechano.garcia@ki.se

Organization name

ScilifeLab - Karolinska Institutet

Department

MTC