 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 31, 2018 |
| Title |
D6.1001200146 |
| Sample type |
SRA |
| |
|
| Source name |
Microglia
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL6N
genotype: wild type
tissue: CB
age: P7
gate: CD45lowCD11b+Gpnmb+Clec7a+
plate_id: 1001200146
well_id: D6
pooled_library_names: N522_GpnmbClec7a_adult
total_counts: 978175
detected_genes: 3627
qc_total_counts: Y
qc_detected_genes: Y
qc_ercc_correlation: Y
qc_all_3_criteria: Y
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cerebella (CB) were dissected out and put into a 6cm petri dish with 200ul cold medium A on ice (15mM HEPES, 0.5% glucose in 1 X Hanks' Balanced Salt Solution (HBSS without phenol red)). Microglia (enriched for PAM with Gpnmb and Clec7a surface markers) extraction was carried out on ice following a published protocol (Bennett et al. PNAS. 2016) through douncing, MACS myelin removal and FACS staining. Single live cells in the CD45lowCD11b+Gpnmb+Clec7a+ gate were sorted into 96-well plates for library preparation.
Sequencing libraries were prepared following the published Smart-seq2 protocol with the aid of liquid handling robotics (Picelli et al. Nature Protocols. 2014). Briefly, plates with sorted cells were thawed on ice and incubated at 72˚C for 3 min in order to anneal RNAs to the Oligo-dT30VN primer. After that, 6ul reverse transcription mixture (95U SMARTScribe™ Reverse Transcriptase (100U/ul, Clontech 639538), 10U RNase inhibitor (40U/ul), 1XFirst-Strand buffer, 5mM DTT, 1M Betaine, 6mM MgCl2, 1uM TSO (Exiqon, Rnase free HPLC purified)) was added into each well, and RT was performed at 42˚C for 90 min, followed by 70˚C, 5 min. To amplify cDNA, 15ul PCR amplification mix (1X KAPA HIFI Hotstart Master Mix (Kapa Biosciences KK2602), 0.1uM ISPCR Oligo (AAGCAGTGGTATCAACGCAGAGT), 0.56U Lambda Exonuclease (5U/ul, New England BioLabs M0262S)) was added, and the following PCR program was used: (1) 37˚C 30 min; (2)95˚C 3 min; (3) 21 cycles of 98˚C 20 sec, 67˚C 15 sec, 72˚C 4 min; (4) 72˚C 5 min. Amplified cDNA samples were then purified with PCRClean DX beads (0.7:1 ratio, Aline C-1003-50), and resuspended in 20ul EB buffer. cDNA quality was examined with a Fragment Analyzer (AATI, High Sensitivity NGS Fragment Analysis Kit:1 bp - 6000 bp) following the manufacture’s instruction. Samples with sufficient amount of cDNA content (>0.05ng/ul) and normal peaks on the quantification graphs were retained for library preparation. To make libraries, all samples were first diluted down to 0.15ng/ul (only if higher than 0.15ng/ul) in 384-well plates using Mantis Liquid Handler (Formulatrix) and Mosquito X1 (TTP Labtech) with customized scripts. Nextera XT DNA Sample Prep Kit (Illumina FC-131-1096) was used at 1/10 of recommendation volume, with the help of a Mosquito HTS robot for liquid transfer. Specifically, tagmentation was done in 1.6ul (1.2ul Tagment enzyme mix, 0.4ul diluted cDNA) at 55˚C, 10 min. Neutralization buffer was added 0.4ul per well and incubated at room temperature for 5 min to stop the reaction. Then 0.8ul Illumina Nextera XT 384 Indexes (0.4ul each, 5uM from 4 sets of 96 indexes) and 1.2ul PCR master mix were added to amplify whole transcriptomes using the following program: (1) 72˚C 3 min; (2) 95˚C 30 sec; (3) 10 cycles of 95˚C 10 sec, 55˚C 30 sec, 72˚C 1 min; (4) 72˚C 5 min. Libraries from a single 384 plate were pooled together in an Eppendorf tube and purified twice with PCRClean DX beads. The quality and concentrations of the final mixed libraries were measured with Bioanalyzer and Qubit, respectively, before Illumina Nextseq sequencing.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Gpnmb_Clec7a_143_Microglia_processed_data.csv
|
| Data processing |
Prinseq (version 0.20.4) was first used to filter sequencing reads shorter than 30 bp (-min_len 30), trim the first 10 bp at the 5’-end (-trim_left 10) of the reads, trim reads with low quality from the 3’-end (-trim_qual_right 25) and remove low complexity reads (-lc_method entropy, -lc_threshold 65).
Trim Galore (version 0.4.3) was applied to trimmed the Nextera adapters (--stringency 1).
The remaining reads were aligned to the mm10 genome by calling STAR (version 2.5.3a) with the following options: --outFilterType BySJout, --outFilterMultimapNmax 20, --alignSJoverhangMin 8, --alignSJDBoverhangMin 1, --outFilterMismatchNmax 999, --outFilterMismatchNoverLmax 0.04, --alignIntronMin 20, --alignIntronMax 1000000, --alignMatesGapMax 1000000, --outSAMstrandField intronMotif.
Picard was then used to remove the duplicate reads (VALIDATION_STRINGENCY=LENIENT, REMOVE_DUPLICATES=true).
The aligned reads were converted to counts for each gene by using HTSeq (-m intersection-nonempty, -s no)
To filter out cells with low sequencing quality, three criteria, namely the number of total reads, the number of total detected genes and correlation coefficient between ERCC spike-ins input and corresponding read counts, were each evaluated based on the distributions of the data. The distribution of the total reads (in logarithmic scale) was fitted by a truncated Cauchy distribution, and data points in two tails of the estimated distribution were considered as outliers and eliminated. Fitting and elimination were then applied to the remaining data. This process was run iteratively until the estimated distribution became stable. The threshold was set to the value where the cumulative distribution function of the estimated distribution reaches 0.05. Similarly, cells with small numbers of detected genes, and poor correlation coefficients for ERCC (low sequencing accuracy) were dropped. After filtering, 1816 cells, out of 1922, were retained.
Genome_build: mm10
Supplementary_files_format_and_content: Common delimited file (csv) containing 143 microglia (enriched for P7 PAM) and mapped gene counts (including counts for ERCC spike-ins).
|
| |
|
| Submission date |
Nov 27, 2018 |
| Last update date |
Dec 31, 2018 |
| Contact name |
Qingyun Li |
| E-mail(s) |
tristan.qingyun.li@gmail.com
|
| Phone |
702-686-6685
|
| Organization name |
Stanford University
|
| Department |
Neurobiology
|
| Street address |
299 Campus Drive
|
| City |
Stanford |
| State/province |
CA |
| ZIP/Postal code |
94305 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE123024 |
Deep single-cell RNAseq of Gpnmb+Clec7a+ microglia from postnatal day 7 cerebellum |
| GSE123030 |
Developmental heterogeneity of microglia and brain myeloid cells revealed by deep single-cell RNA sequencing |
|
| Relations |
| BioSample |
SAMN10486854 |
| SRA |
SRX5067474 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
