 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 12, 2019 |
| Title |
E12_DFL_invNsi-Itga6_H3K27me3_ChIP-seq |
| Sample type |
SRA |
| |
|
| Source name |
Distal forelimb mouse E12.5 invHoxd(TgHd11lacNsi-Itga6) H3K27me3 ChIPmentation
|
| Organism |
Mus musculus |
| Characteristics |
strain: B6CBAF1
genotype: invHoxd(TgHd11lacNsi-Itga6)
embryonic day: E12.5
tissue: Distal Forelimbs
antibody: H3K27me3 (Millipore, Cat 17-622, 3μg )
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Micro-dissected proximal and distal segments of E12.5 forelimbs either from wild type or mutant embryos (delHoxD(attP-Rel5)d9lac, invHoxD(attP-Itga6), invHoxD(TgHd11lacNsi-Itga6)). Tissues were dissected, fixed in 1% formaldehyde (in PBS) for 10 min at room temperature and the reaction was quenched with Stop Solution from the ChIP-IT High sensitive kit (Active Motif). Samples were then washed 3 times with working Washing Solution (ChIP-IT, Active Motif) and then snap-frozen in liquid nitrogen and stored at -80ºC until further processing. After genotyping, samples were pooled according to the required cell number. The total amount of tissue used for each line was different due to the size variations of the limb buds. Limb tissues were disrupted with a polytron device, lysed in RIPA buffer or Prep Buffer (ChIP-IT, Active Motif) and sonicated in Diagenode Bioruptor Pico. All H3K27ac ChIP experiments were processed as ChIP-seqs using the reagents from ChIP-IT High Sensitive kit (Active Motif). IPs were performed in parallel technical duplicates with 11 to 14μg of chromatin on each. Antibody incubation was performed overnight on a final volume of 1.5-2ml dilution buffer (0.1% SDS, 50mM Tris-HCl pH8, 10mM EDTA pH8 and proteinase inhibitors), including 2μl of H3K27ac antibody (Diagenode C15410196) at 4°C on a rotating platform. Agarose beads were added for 3 to 4h at 4ºC. Washes were performed on column and DNA purification was carried out by phenol-chloroform extraction. The technical replicates were merged and yielded 1.5 to 2ng of chromatin, which were used to generate DNA libraries using the TruSeq ChIP library preparation kit. RING1B ChIP-seq experiments were processed as for ChIP-seq using 4μl of RING1B antibody (Active Motif 39664) as described in (Beccari et al. 2016; PMID:27198226). All H3K27me3 and EZH2 ChIP were performed following the ChIPmentation protocol . Around 0.1 to 0.4 million cells were used for each IP on a final volume of 800 to 1000μl of RIPA-LS buffer (10mM Tris-HCl pH8, 140mM NaCl, 1mM EDTA pH8, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton x-100 and proteinase inhibitors), to which 2μl of H3K27me3 (Millipore 17-622) or EZH2 (Diagenode C15410039) antibodies were added. Samples were incubated for at least 2 hours with Dynabeads Protein A (Invitrogen 10001D) rotating at 4ºC. Washes were performed as follows: two times RIPA-LS, two times RIPA-HS (10mM Tris-HCl pH8, 500mM NaCl, 1mM EDTA pH8, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton x-100 and proteinase inhibitors), two times RIPA-LiCl (10mM Tris-HCl pH8, 250mM LiCl, 1mM EDTA pH8, 0.5% NP-40, 0.5% sodium deoxycholate and proteinase inhibitors) and once with 10mM Tris-HCl pH8. Beads were resuspended in 24μl of tagmentation buffer (10mM Tris pH8, 5mM MgCl2, 10% dimethylformamide) and 1μl of Tn5 transposase (Illumina 15027865, from Nextera DNA Library Prep Kit 15028212) and transferred to PCR tubes, which were then incubated at 37ºC for five minutes in a thermocycler. Samples were then resuspended and washed twice in 1ml of RIPA-LS and twice in 1ml TE buffer (10mM Tris-Hcl pH8, 1mM EDTA pH8). Beads were magnetised, DNA was eluted in ChIP elution buffer (10mM Tris-HCl pH8, 5mM EDTA pH8, 300mM NaCl, 0.4% SDS) with 2μl of proteinase K (20mg/ml stock) and then incubated for 1 hour at 55ºC and 6 hours to overnight at 65ºC. After de-crosslinking, the supernatant was recovered and beads were resuspended again in 19μl ChIP elution buffer with 1μl of proteinase K and left 1 hour at 55ºC. The two supernatants were combined and purified with MinElute kit (Qiagen) in 22μl of EB buffer. Relative quantitation was performed using SYBR-green as in (Schmidl et al, 2015; PMID:26280331) using 2μl of DNA. Libraries were amplified according to the Cq values obtained in the previous step (12 to 14 cycles for both sets of samples), purified using Agentcourt AMPureXP beads (Beckman Coulter A63880) and eluted in 15μl of water. DNA sequencing was performed in HiSeq 2500 or HiSeq 4000 machine as 50bp single reads or 100bp single reads.
Libraries of ChIP experiments of H3K27me3 and EZH2 were generated following the ChIPmentation protocol (Schmidl et al, 2015; PMID:26280331). H3K27ac and RING1B ChIP-seq libraries were generated following the TrueSeq Illumina protocol.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Analyses were performed using the facilities of the Scientific IT and Application Support Center of EPFL. Sequences were filtered and adapters were removed using cutadapt (v1.16) with parameters -m 15 -q 30 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC for ChIPmentation and -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC for ChIP-seq. Reads were mapped on mm10 using bowtie2 (v2.3.4.1) using default parameters. Only reads with a mapping quality above 30 were kept. A profile was obtained with macs2 (version 2.1.1.20160309 option –extsize 300). Bedgraphs were normalized to their number of million tags used in the profile and replicates were merged using the tool unionbedg (bedtools v2.27). An artifactual peak, which is due to a PCR contamination, was found in region chr2:74207282-74208158 in some datasets.
Genome_build: mm10
Supplementary_files_format_and_content: mean of normalized macs2 bedgraphs
|
| |
|
| Submission date |
Apr 05, 2019 |
| Last update date |
Feb 19, 2020 |
| Contact name |
Eddie Rodríguez-Carballo |
| E-mail(s) |
edgardo.rodriguez@unige.ch
|
| Organization name |
Université de Genève
|
| Department |
Department of Genetics and Evolution
|
| Street address |
4, Boulevard d'Yvoy
|
| City |
Geneva |
| ZIP/Postal code |
1205 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE129425 |
Impact of genome architecture upon the functional activation and repression of Hox regulatory landscapes [ChIP-seq] |
| GSE129427 |
Impact of genome architecture upon the functional activation and repression of Hox regulatory landscapes |
|
| Relations |
| BioSample |
SAMN11352846 |
| SRA |
SRX5649292 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3712738_E12_DFL_invNsi-Itga6_H3K27me3_neq2.bedGraph.gz |
209.8 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
