|
| Status |
Public on Nov 13, 2020 |
| Title |
U937_myb 4C |
| Sample type |
SRA |
| |
|
| Source name |
histiocytic lymphoma cells
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: pleural effusion
tumor: histiocytic lymphoma
treatment: normal culture
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
10×106 cells were cross-linked by 2% formaldehyde for 10 min and 0.125 M glycine was added to prevent further cross-linking. Cells were collected and washed with 14 ml PBS twice, then cells were centrifuged and suspended in lysis buffer to disrupt membranes and isolate chromatin. A primary 6-base cutter, 400 U HindⅢ was used for the first digestion at 37°C with shaking overnight followed by diluted ligations. After precipitation, chromatin was further subjected to a second round of digestions with a 4-base cutter Dpn Ⅱ and ligation. Primers for the c-myb viewpoint (forward, AGTATTAATTTGCC-TTGTCC; reverse, GCTAATGTTGGATATATTGC) were designed. Inverse polymerase chain reaction (PCR) was carried out to amplify sample libraries.
Libraries were pooled and sequenced using the Illumina HiSeq machine as 150-bp paire-end sequencing reads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Illumina Casava1.8 software used for basecalling.
4C-Seq reads were trimmed for adaptor sequence and are mapped to a reduced genome consisting of unique sequence fragments adjacent to the primary restriction enzyme sites in the genome using bowtie2 with parameters -p 4 -N 0 -5 34 -3 80
Removing the self-ligated and undigested fragments
Analyzing 4C interactions using 4C-ker
Genome_build: hg19
Supplementary_files_format_and_content: BedGraph files include normalized counts for long-range interactions by 4C-ker
|
| |
|
| Submission date |
Nov 13, 2019 |
| Last update date |
Nov 14, 2020 |
| Contact name |
Mengjia Li |
| E-mail(s) |
mengjia.li@outlook.com
|
| Organization name |
Shanghai Ocean University
|
| Department |
College of Fisheries and Life Science
|
| Lab |
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources
|
| Street address |
999 Hucheng Ring Road
|
| City |
Shanghai |
| ZIP/Postal code |
201306 |
| Country |
China |
| |
|
| Platform ID |
GPL20795 |
| Series (1) |
| GSE140321 |
Distal regulation of c-myb expression in human myeloid leukemia cells |
|
| Relations |
| BioSample |
SAMN13279745 |
| SRA |
SRX7135329 |
